CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Piper Retrofractum

Example Image

PLANiTS DNA barcode

Click for details-----ITS

AGTAGTGACCTGCGGAGGATCATTGTCGATGCCCATCGGAACAAGCACAGACGGAAGCGAACTTGTGAACCCTCGTTCTTGGCCCGCGCGTTGCCCAGCACGCGTCGGGCAACAACGAACAAAATCCCGGCGCAGGACGCGCCAAGCAACTCGGGAAGCTTTGATTGCGGCGTCCTCTTTCCCTATCGGGCTTTAGAGGGCACGCGGCGAACACTAATAAGTCAAATACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTTCAGGTCGAGGGCACATCTGCTTGGGCGTTAAACAAGTCGTCTCCCACCGCCTTCTCCCTCCGCACTCCGAGCAAGGAGACTGTCCGGGATGAGGGTGGGTTGGGCGGAGTCTGGTCGTCCGTGTGCCCGCAGCGCATGCGGTCGGCTGAAAAGCCTTGGGCCACGGGCTGCGTGCGGCTCAACGGGTGGTGGTTGTGCGCCCCAGGGAAGGCCACGATTGTCAGCAGCGTTGCGCCGTTCGCTTCTCGATTGCCCGGCAAGTACCCACACAATCGAAACATCCAATCGACGGATCGATTCGAATGCAACCCC

Click for details-----ITS1

Click for details-----ITS2

AAGTCGTCTCCCACCGCCTTCTCCCTCCGCACTCCGAGCAAGGAGACTGTCCGGGATGAGGGTGGGTTGGGCGGAGTCTGGTCGTCCGTGTGCCCGCAGCGCATGCGGTCGGCTGAAAAGCCTTGGGCCACGGGCTGCGTGCGGCTCAACGGGTGGTGGTTGTGCGCCCCAGGGAAGGCCACGATTGTCAGCAGCGTTGCGCCGTTCGCTTCTCGATTGCCCGGCAAGTACCCACACAATCGAAACATCCAATCGACGGATCGATTCGAATGCAACCCC

Taxonomic Information

Plant ID: NPO6648
Plant Latin Name: Piper Retrofractum
Taxonomy Genus: Piper
Taxonomy Family: Piperaceae

Plant External Links:

NCBI TaxonomyDB: 130414
Plant-of-the-World-Online: 683079-1

Used in Medicines

Country/Region:

Thailand; Indonesia; India; China

Traditional Medicine System:

Sowa-Rigpa; TCM; Unani; Ayurveda; Siddha

Geographical Distribution

Bangladesh; Philippines; Indonesia; India; Cambodia; Vietnam; China; Laos; Thailand

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

102 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

48 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

51 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC99298

Ingredient ID: NPC9912

Ingredient ID: NPC99078

Ingredient ID: NPC99006

Ingredient ID: NPC94280

Ingredient ID: NPC90174

Ingredient ID: NPC84718

Ingredient ID: NPC81249

Ingredient ID: NPC76268

Ingredient ID: NPC73883

Ingredient ID: NPC7359

Ingredient ID: NPC71105

Ingredient ID: NPC53773

Ingredient ID: NPC53069

Ingredient ID: NPC5238

Ingredient ID: NPC51352

Ingredient ID: NPC49075

Ingredient ID: NPC48143

Ingredient ID: NPC472026

Ingredient ID: NPC472024

Ingredient ID: NPC41331

Ingredient ID: NPC3910

Ingredient ID: NPC38566

Ingredient ID: NPC308240

Ingredient ID: NPC306420

Ingredient ID: NPC306255

Ingredient ID: NPC305799

Ingredient ID: NPC305602

Ingredient ID: NPC303727

Ingredient ID: NPC303672

Ingredient ID: NPC302531

Ingredient ID: NPC302519

Ingredient ID: NPC300505

Ingredient ID: NPC295895

Ingredient ID: NPC294756

Ingredient ID: NPC291449

Ingredient ID: NPC285596

Ingredient ID: NPC277042

Ingredient ID: NPC273416

Ingredient ID: NPC273023

Ingredient ID: NPC268041

Ingredient ID: NPC267442

Ingredient ID: NPC266744

Ingredient ID: NPC264784

Ingredient ID: NPC261158

Ingredient ID: NPC256452

Ingredient ID: NPC255817

Ingredient ID: NPC255675

Ingredient ID: NPC254694

Ingredient ID: NPC253344

Ingredient ID: NPC252107

Ingredient ID: NPC251466

Ingredient ID: NPC24216

Ingredient ID: NPC234967

Ingredient ID: NPC23376

Ingredient ID: NPC233726

Ingredient ID: NPC23134

Ingredient ID: NPC230698

Ingredient ID: NPC23035

Ingredient ID: NPC225745

Ingredient ID: NPC223834

Ingredient ID: NPC221090

Ingredient ID: NPC220923

Ingredient ID: NPC214036

Ingredient ID: NPC211608

Ingredient ID: NPC207541

Ingredient ID: NPC202468

Ingredient ID: NPC199402

Ingredient ID: NPC199209

Ingredient ID: NPC19839

Ingredient ID: NPC196609

Ingredient ID: NPC195986

Ingredient ID: NPC194266

Ingredient ID: NPC190904

Ingredient ID: NPC185639

Ingredient ID: NPC171928

Ingredient ID: NPC171872

Ingredient ID: NPC170583

Ingredient ID: NPC167096

Ingredient ID: NPC166725

Ingredient ID: NPC16634

Ingredient ID: NPC159362

Ingredient ID: NPC157740

Ingredient ID: NPC156944

Ingredient ID: NPC155753

Ingredient ID: NPC152384

Ingredient ID: NPC152186

Ingredient ID: NPC150195

Ingredient ID: NPC145154

Ingredient ID: NPC140857

Ingredient ID: NPC13826

Ingredient ID: NPC136330

Ingredient ID: NPC135155

Ingredient ID: NPC124863

Ingredient ID: NPC120066

Ingredient ID: NPC118885

Ingredient ID: NPC115688

Ingredient ID: NPC110740

Ingredient ID: NPC109955

Ingredient ID: NPC105821

Ingredient ID: NPC105550

Ingredient ID: NPC100163

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 1	CYP1B1	Cytochrome P450 1B1	Q16678	CHEMBL4878
Cytochrome P450	Cytochrome P450 family 3	CYP3A4	Cytochrome P450 3A4	P08684	CHEMBL340
Therapeutic Target	Hydrolase	ACHE	Acetylcholinesterase	P22303	CHEMBL220
Therapeutic Target	Oxidoreductase	MAOB	Monoamine oxidase B	P27338	CHEMBL2039
Therapeutic Target	Small molecule receptor (family A GPCR)	DRD1	Dopamine D1 receptor	P21728	CHEMBL2056
Therapeutic Target	Small molecule receptor (family A GPCR)	DRD3	Dopamine D3 receptor	P35462	CHEMBL234
Therapeutic Target	Small molecule receptor (family A GPCR)	DRD5	Dopamine D5 receptor	P21918	CHEMBL1850
Therapeutic Target	Small molecule receptor (family A GPCR)	DRD2	Dopamine D2 receptor	P14416	CHEMBL217
Therapeutic Target	Small molecule receptor (family A GPCR)	CNR2	Cannabinoid CB2 receptor	P34972	CHEMBL253
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235
Therapeutic Target	Transient receptor potential channel	TRPV1	Vanilloid receptor	Q8NER1	CHEMBL4794

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	13

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT02226185	Study of Berberine Hydrochloride in Prevention of Colorectal Adenomas Recurrence	colorectal adenoma	Berberine (NPC53069)	NP level
NCT01383694	Effect Of Piperine In Patients With Oropharyngeal Dysphagia	Dysphagia	Piperine (NPC136330)	NP level
NCT01893424	Bioequivalence Assessment of Oral Administration Vs. Oral Spray of a Cannabinoids (Tetrahydrocannabinol and Cannabidiol)	pain	Piperine (NPC136330)	NP level
NCT02548832	Bezafibrate Plus Berberine in Mixed Dyslipidemia	Combined hyperlipidemia	Berberine (NPC53069)	NP level
NCT03486496	Gefitinib and Berberine in the First-line Treatment of Lung Adenocarcinoma With EGFR Mutation	lung adenocarcinoma	Berberine (NPC53069)	NP level
NCT02082756	Effects of Berberine Hydrochloride and Bifidobacterium in Prediabetes Prevention and Treatment	prediabetes syndrome	Berberine (NPC53069)	NP level
NCT00633282	Role of Pioglitazone and Berberine in Treatment of Non-Alcoholic Fatty Liver Disease	non-alcoholic fatty liver disease	Berberine (NPC53069)	NP level
NCT02084004	Effects of Berberine Hydrochloride and Bifidobacterium in Diabetes Mellitus Prevention and Treatment	type 2 diabetes mellitus	Berberine (NPC53069)	NP level
NCT00425009	Therapeutic Effects of Berberine in Patients With Type 2 Diabetes	type 2 diabetes mellitus	Berberine (NPC53069)	NP level
NCT02861261	A Study on the Efficacy and Gut Microbiota of Berberine and Probiotics in Patients With Newly Diagnosed Type 2 Diabetes	type 2 diabetes mellitus	Berberine (NPC53069)	NP level
NCT05430087	Vitamin D and Curcumin Piperine Attenuates Disease Activity and Cytokine Levels in Systemic Lupus Erythematosus Patients	systemic lupus erythematosus	Piperine (NPC136330)	NP level
NCT03281096	A Research of Berberine Hydrochloride to Prevent Colorectal Adenomas in Patients With Previous Colorectal Cancer	colorectal adenoma	Berberine (NPC53069)	NP level
NCT03333265	Primary Chemoprevention of Familial Adenomatous Polyposis With Berberine Hydrochloride	colorectal adenoma	Berberine (NPC53069)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	ACHE,LMNA,DRD1,CNR2,CYP1B1,MAOB,DRD2
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	ACHE,DRD1,CNR2,CYP1B1,CYP3A4,DRD2
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	TRPV1,DRD2,CNR2,ACHE NCT01893424
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	DRD1,ACHE,DRD3,MAOB,DRD2
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	DRD2,ACHE,DRD3,MAOB
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	MAOB,DRD2,DRD2,DRD1
General pain disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E43	MAOB,DRD2,CNR2,TRPV1
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	DRD2 NCT02861261,NCT00425009,NCT02084004
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	ACHE,LMNA,MAOB,CNR2
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	LMNA,DRD1,DRD2,CNR2
Allergic/hypersensitivity disorder Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A80-4A8Z	DRD2,DRD1,DRD5
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	DRD2,DRD3,DRD1
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	ACHE,DRD1,MAOB
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	TRPV1,CYP3A4,CNR2
Depression Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A70-6A7Z	DRD3,MAOB,DRD2
Attention deficit hyperactivity disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A05	DRD2,DRD3,CNR2
Migraine Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A80	MAOB,TRPV1,DRD2
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	DRD3,CYP3A4,DRD2
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	ACHE,DRD2 NCT05430087
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	NCT02226185,NCT03281096,NCT03333265
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	ACHE,DRD5,DRD2
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	ACHE,CNR2,DRD2
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	ACHE,DRD1,CNR2
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	ACHE,DRD2
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	DRD3,DRD2
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	DRD3,DRD2
BCR-ABL1-negative chronic myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A41	DRD2,DRD3
Stomach cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	DRD3,DRD2
Sexual dysfunction Disease Category: 17.Conditions related to sexual health Disease ICD-11 Code: HA00-HA01	DRD3,DRD2
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	ACHE,DRD2
Nausea/vomiting Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MD90	DRD2,MAOB
Gastroduodenal motor/secretory disorder Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA41	DRD2,DRD3
Endometrial cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76	DRD2,DRD3
Psychotic disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20-6A25	DRD1,DRD2
Anxiety Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB24.3	CYP3A4,DRD2
Acute upper respiratory infection Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA07	DRD2,DRD3
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	DRD3,DRD2
Bipolar disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A60	DRD2,DRD3
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	DRD2,TRPV1
Insomnia Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7A0Z	CNR2,DRD2
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	DRD5,DRD2
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	ACHE,LMNA
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	LMNA,CYP1B1
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CYP3A4,DRD2
Essential hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00	DRD2
Skin cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30-2C37	MAOB
Acquired hypomelanotic disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED63	MAOB
Schizoaffective disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A21	DRD2
Abortion Disease Category: 18.Pregnancy, childbirth or the puerperium Disease ICD-11 Code: JA00	DRD1
Gangrene Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MC85	DRD2
NA Disease Category: NA Disease ICD-11 Code: NA	DRD2
Unspecific substance harmful effect Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE6Z	ACHE
Oesophageal/gastroduodenal disorder Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD90	ACHE
Visual system disease Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9E1Z	TRPV1
Itching Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F28-1G07	DRD2
Restless legs syndrome Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A80	DRD2
Functional bladder disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GC50	TRPV1
Cocaine use disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C45	DRD1
Intellectual development disorder Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD90	DRD2
Hyperaemia Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9A61-9B7Y	DRD2
Hypotension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA20-BA21	DRD2
Lower limb mononeuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C11	TRPV1
Heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10-BD1Z	DRD2
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	DRD2
Primary psychotic disorder manifestation Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A25	MAOB
Inborn lipid metabolism error Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C52	CNR2
Nasopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6B	DRD3
Chronic pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG30	TRPV1
Psychoactive substances use disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C4G	DRD3
Muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70	MAOB
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	TRPV1
Osteoarthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA00-FA05	TRPV1
Breathing abnormality Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MD11	DRD2
Postpartum haemorrhage Disease Category: 18.Pregnancy, childbirth or the puerperium Disease ICD-11 Code: JA43	DRD2
Pediculosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G00	ACHE
Thyrotoxicosis Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A02	DRD2
Knee osteoarthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA01	TRPV1
Inborn porphyrin/heme metabolism error Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C58	DRD2
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	DRD2
Carcinoid syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B10	DRD2
Faecal incontinence Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: ME07	DRD2
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	MAOB
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	CNR2
Pituitary gland disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A60-5A61	DRD2
Digestive system disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DE2Z	DRD2
Malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F40-1F45	MAOB
Myasthenia gravis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C6Y	ACHE
Idiopathic interstitial pneumonitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03	DRD2
Cerebral ischaemia Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B1Z	DRD2
Skin tag/polyp Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EK71	MAOB
Choreiform disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A01	DRD2
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	DRD2
Parasitic worm infestation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F90	ACHE
Endocrine gland neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2F37	DRD2
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	DRD2
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	DRD2
Tic disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A05	DRD1
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	ACHE
Mixed hyperlipidaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80.2	NCT02548832
Adenocarcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D40	NCT03486496
Intermediate hyperglycaemia, unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A40.Z	NCT02082756
Non-alcoholic fatty liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB92	NCT00633282
Dysphagia Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MD93	NCT01383694
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	DRD5
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	ACHE
Dengue fever, unspecified Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D2Z	DRD3
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	LMNA
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	DRD5
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	CNR2
Idiopathic pulmonary fibrosis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03.4	DRD5
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	DRD1
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	DRD5
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	ACHE
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	DRD2
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	ACHE
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	DRD2
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	ACHE
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	CYP3A4
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	CYP1B1
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	ACHE
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	LMNA
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	CNR2
Heart failure, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD1Z	CYP1B1
Human immunodeficiency virus disease without mention of tuberculosis or malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C62	CNR2
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	CYP1B1
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	ACHE
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	CYP3A4

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Piper Retrofractum

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

102 All known Ingredients in Total

48 Ingredients with Acceptable Bioavailablity

51 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Adenocarcinoma of pancreas

Malignant neoplasms of thymus

Pain, unspecified

Parkinsonism

Alzheimer disease

Pulmonary hypertension

General pain disorder

Type 2 diabetes mellitus

Diffuse large B-cell lymphomas

Mesothelioma of pleura

Allergic/hypersensitivity disorder

Schizophrenia

Dementia

Atopic eczema

Depression

Attention deficit hyperactivity disorder

Migraine

Solid tumour/cancer

Systemic lupus erythematosus

Colorectal cancer

Pheochromocytoma

Cytomegaloviral disease

Germ cell tumour of testis

Glaucoma

Brain cancer

Mature T-cell lymphoma

BCR-ABL1-negative chronic myeloid leukaemia

Stomach cancer

Sexual dysfunction

Substance abuse

Nausea/vomiting

Gastroduodenal motor/secretory disorder

Endometrial cancer

Psychotic disorder

Anxiety

Acute upper respiratory infection

Multiple myeloma

Bipolar disorder

Asthma

Insomnia

Serous cystadenoma,borderline malignancy of ovary

Superficial ovarian endometriosis

Glioblastoma of brain

Renal cell carcinoma, chromophobe type

Essential hypertension

Skin cancer

Acquired hypomelanotic disorder

Schizoaffective disorder

Abortion

Gangrene

NA

Unspecific substance harmful effect

Oesophageal/gastroduodenal disorder

Visual system disease

Itching

Restless legs syndrome

Functional bladder disorder

Cocaine use disorder

Intellectual development disorder

Hyperaemia

Hypotension

Lower limb mononeuropathy