• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Clematis Chinensis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGATACCTGCTCAGCAGAACGACCCGCGAACACGTGAAAACAACCACACGCAGGGACCCCCGTCCCCGCCTGCTAATCAAAACCCGGCGCGACAAGCGTCAAGGAAAACTTAGCGGAAACAAGGGGAAGGCCCGTCACAGGGACGACCCCAAGAATCCGAACACCCAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGTCTTTTAGACCGAGGGCACGTCTGCCTGGGCGTCACACACAGCGTCGCCCCCCACCAACCCGTTGGCTGGGGGACGGAAACTGGCCCCCCGAGCCCCCCCGGGCACGGCCGGCACAAATGTTGGTCCTCGGCGGCGAGCGTCGCGGTCAGCGGTGGTTGTACCCTCACCCCCCAAAGACAGAAACGACGCGCACGCCTCGCCGCACGCAGGCGTAACGAACCCAGAGAAGCCCTCCCCGGAGGGACCTCAACCTGCGAC

Click for details-----ITS1

TCGATACCTGCCCAGCAGAACGACCCGCGAACACGTGAAAACAACCACACGCAGGGACCCTGGTCCCCGCCTGCTAATCAAAACCCGGCGCGACAAGCGTCAAGGAAAACTTAGCGGAAACAAGGGGAAGGCCCTCCACGAGGACGACCGACCCCAAGAATCCGAAGACCCAAA

Click for details-----ITS2

ACAGCGTCGCCCCCCACCAACCCGTTTTGGGCTGGGGGACGGAAACTGGCCCCCCGAGCCCCCACGGGCACGGTCGGCACAAATGTTGGTCCTCGGCGGCGAGCGTCGCGGTCAGCGGGGGTTGTATTTCTCACCCCCAAAGACAGAAACGACGCGCACGCCTCGCCGCACGCAGGCGTAACGAACCCCAGGAAGCTCTCCCCGGAGACTTCAAC
Taxonomic Information

Plant ID: NPO6583
Plant Latin Name: Clematis Chinensis
Taxonomy Genus: Clematis
Taxonomy Family: Ranunculaceae

Plant External Links:

NCBI TaxonomyDB: 748693
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM; Kampo


Medicinal Functions:

Anodyne; Antidote; Antiperiodic; Antirheumatic; Antispasmodic; Antitumor; Cancer; Carminative; Diuretic

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

106 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


66 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

58 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99886

Ingredient ID: NPC93479

Ingredient ID: NPC85813

Ingredient ID: NPC75426

Ingredient ID: NPC75263

Ingredient ID: NPC75158

Ingredient ID: NPC71065

Ingredient ID: NPC70410

Ingredient ID: NPC68889

Ingredient ID: NPC68295

Ingredient ID: NPC67857

Ingredient ID: NPC469782

Ingredient ID: NPC469778

Ingredient ID: NPC469777

Ingredient ID: NPC469776

Ingredient ID: NPC469775

Ingredient ID: NPC469774

Ingredient ID: NPC469773

Ingredient ID: NPC469772

Ingredient ID: NPC46254

Ingredient ID: NPC4328

Ingredient ID: NPC329148

Ingredient ID: NPC32723

Ingredient ID: NPC322418

Ingredient ID: NPC315459

Ingredient ID: NPC315019

Ingredient ID: NPC31257

Ingredient ID: NPC310025

Ingredient ID: NPC308749

Ingredient ID: NPC307063

Ingredient ID: NPC307050

Ingredient ID: NPC307041

Ingredient ID: NPC305846

Ingredient ID: NPC303759

Ingredient ID: NPC301583

Ingredient ID: NPC298034

Ingredient ID: NPC295941

Ingredient ID: NPC292792

Ingredient ID: NPC291545

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC287550

Ingredient ID: NPC287505

Ingredient ID: NPC284039

Ingredient ID: NPC28325

Ingredient ID: NPC28198

Ingredient ID: NPC279026

Ingredient ID: NPC277917

Ingredient ID: NPC273607

Ingredient ID: NPC271118

Ingredient ID: NPC268564

Ingredient ID: NPC261506

Ingredient ID: NPC259512

Ingredient ID: NPC257566

Ingredient ID: NPC256295

Ingredient ID: NPC25407

Ingredient ID: NPC250265

Ingredient ID: NPC243728

Ingredient ID: NPC241909

Ingredient ID: NPC239406

Ingredient ID: NPC236638

Ingredient ID: NPC236550

Ingredient ID: NPC230301

Ingredient ID: NPC229

Ingredient ID: NPC227986

Ingredient ID: NPC223697

Ingredient ID: NPC223695

Ingredient ID: NPC22140

Ingredient ID: NPC216630

Ingredient ID: NPC214584

Ingredient ID: NPC21180

Ingredient ID: NPC209971

Ingredient ID: NPC194458

Ingredient ID: NPC192977

Ingredient ID: NPC179694

Ingredient ID: NPC176521

Ingredient ID: NPC174720

Ingredient ID: NPC164419

Ingredient ID: NPC163556

Ingredient ID: NPC161717

Ingredient ID: NPC161108

Ingredient ID: NPC158702

Ingredient ID: NPC156630

Ingredient ID: NPC143806

Ingredient ID: NPC143168

Ingredient ID: NPC140969

Ingredient ID: NPC139325

Ingredient ID: NPC136996

Ingredient ID: NPC135334

Ingredient ID: NPC127122

Ingredient ID: NPC124318

Ingredient ID: NPC123611

Ingredient ID: NPC122318

Ingredient ID: NPC119949

Ingredient ID: NPC119592

Ingredient ID: NPC115061

Ingredient ID: NPC114464

Ingredient ID: NPC114328

Ingredient ID: NPC111888

Ingredient ID: NPC110895

Ingredient ID: NPC107482

Ingredient ID: NPC104071

Ingredient ID: NPC103497

Ingredient ID: NPC102439

Ingredient ID: NPC100925

Ingredient ID: NPC100773