• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Aconitum Vilmorinianum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGAAACCTGCCCAGCAGAGCGACCCGCGAACAAGTGAAAACAAATCTGGACGAACCGAAGAGGGGCGCATGCCCCCGATCGCTCGCCCGTCGGACCACGACCTCTTCTGCGACCGCATTGATCTGCGGGCGGAGGGGTGGGTCGTTGTGTCCGCACAAAACCAAAAACCGGCGCGACAGGCGTCAAGGAAATCTTAGCGGAAAAAGAGGGTTGCCCCGTCCGCGGTGGCAGCCTTCAGAATCCGATACTCAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO651
Plant Latin Name: Aconitum Vilmorinianum
Taxonomy Genus: Aconitum
Taxonomy Family: Ranunculaceae

Plant External Links:

NCBI TaxonomyDB: 226101
Plant-of-the-World-Online: 707943-1

Used in Medicines

Unknown.

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

47 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


26 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

31 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC88566

Ingredient ID: NPC85813

Ingredient ID: NPC75204

Ingredient ID: NPC7133

Ingredient ID: NPC68889

Ingredient ID: NPC59581

Ingredient ID: NPC58957

Ingredient ID: NPC48347

Ingredient ID: NPC3649

Ingredient ID: NPC36061

Ingredient ID: NPC33489

Ingredient ID: NPC301585

Ingredient ID: NPC295777

Ingredient ID: NPC294548

Ingredient ID: NPC293378

Ingredient ID: NPC290495

Ingredient ID: NPC290287

Ingredient ID: NPC289668

Ingredient ID: NPC27184

Ingredient ID: NPC266389

Ingredient ID: NPC258314

Ingredient ID: NPC248053

Ingredient ID: NPC222781

Ingredient ID: NPC214399

Ingredient ID: NPC209970

Ingredient ID: NPC209252

Ingredient ID: NPC208936

Ingredient ID: NPC208363

Ingredient ID: NPC20791

Ingredient ID: NPC205334

Ingredient ID: NPC201562

Ingredient ID: NPC182395

Ingredient ID: NPC18205

Ingredient ID: NPC179950

Ingredient ID: NPC176740

Ingredient ID: NPC175378

Ingredient ID: NPC17481

Ingredient ID: NPC160126

Ingredient ID: NPC152438

Ingredient ID: NPC149184

Ingredient ID: NPC144109

Ingredient ID: NPC122768

Ingredient ID: NPC120217

Ingredient ID: NPC119817

Ingredient ID: NPC116775

Ingredient ID: NPC106840

Ingredient ID: NPC102280