• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Datura Stramonium


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCAAAGCAGAACGACCCGCGAACCTGTTTAAACACTTAGGGAGCCGCGCGGGCGGGGTGCTTCGGCCCTCCTCCGTGCGTCTCCCTCCCGTCCCCGGCACGCGCTCGTGTGCGTGTCTGGTGATTAACGAACCCCGGCGCGAAAAGCGCCAAGGAATACTTAATTGATAGCCTGCCTCTCGCGCCCCGTCCGCGGTGCGCGCGGGAGGGCCTGTGCTTCTTTTTAAACAAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCGCACTCCGCGCCCAAAATCTTGGCCGCGGTTGTGTCGTGGGACGGATATTGGCCTCCCGTGAGCCCCCGAGCCCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCACGGCAAGTGGTGGTTGGAACTCAACTCTCGTAATGTCGTGGCTACAGCCCGTCGCTCGTTTGTGCTCCTAGACCCTTCACGCGCTTAGGCGCTCCGACCGCGACCCCAGGT

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGTTGCCCCCAAACCTTGTCGTCCCTTCGGTCAACCGGAGGAGATGAGGTGCTTGGGCGGAAGTTGGCCTCCCGTGAGCATTGCCTCGCGGATGGTCGAAATTGGAGCCTGTGGGGAGCGACGGACACGTTCCACGGTGGTTGAGGAGATGCCTCGAAGGTCAACCGTGCGCGAGTTGTCCCCACGTCAAAGGCTGCGAGACCCTTGCGACCAAGAAAGTGCTCCCA
Taxonomic Information

Plant ID: NPO6495
Plant Latin Name: Datura Stramonium
Taxonomy Genus: Datura
Taxonomy Family: Solanaceae

Plant External Links:

NCBI TaxonomyDB: 4076
Plant-of-the-World-Online: 314738-2

Used in Medicines

Country/Region:
China; Indonesia; India

Traditional Medicine System:
Indian Folk; Unani; Siddha; Ayurveda; TCM; Homeopathy


Medicinal Functions:

Anodyne; Anthelmintic; Antiasthmatic; Antidandruff; Antiinflammatory; Antispasmodic; Hallucinogenic; Hypnotic; Mydriatic; Narcotic

Geographical Distribution

Turkmenistan; Ethiopia; Swaziland; Argentina; Bolivia; Cameroon; Ghana; Saudi Arabia; Cape Verde; Spain; Netherlands; Jamaica; Tanzania; New Zealand; Yemen; Pakistan; Albania; India; Lesotho; Kenya; Tajikistan; Turkey; Afghanistan; Bangladesh; Eritrea; France; Rwanda; Somalia; Peru; Laos; Norway; Cote d'Ivoire; Benin; Cuba; Togo; China; Dominican Republic; Ukraine; Libya; Indonesia; Mauritius; Sweden; Belarus; Mali; Russia; Bulgaria; United States; Romania; Angola; Portugal; South Africa; Cyprus; Austria; Mozambique; Uganda; Hungary; Niger; Brazil; Guinea; Costa Rica; Bahamas; Nigeria; Ecuador; Australia; Iran; Algeria; Chile; Belgium; Haiti; Belize; Gambia; Poland; Morocco; Namibia; Switzerland; Iraq; Chad; Mexico; Uzbekistan; Tunisia; Colombia; Burundi; Taiwan; Fiji; Madagascar; Italy; Sudan; Nepal; Venezuela; Zambia; Malawi; Zimbabwe; Germany; Denmark; Kazakhstan; Mauritania; Trinidad and Tobago; Honduras; Myanmar; Equatorial Guinea; Egypt; United Kingdom; Congo; Greece; Sri Lanka; Botswana

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

91 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


86 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

23 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC97820

Ingredient ID: NPC97212

Ingredient ID: NPC91824

Ingredient ID: NPC84281

Ingredient ID: NPC79557

Ingredient ID: NPC78831

Ingredient ID: NPC76336

Ingredient ID: NPC74906

Ingredient ID: NPC69496

Ingredient ID: NPC5754

Ingredient ID: NPC55285

Ingredient ID: NPC46780

Ingredient ID: NPC45371

Ingredient ID: NPC43642

Ingredient ID: NPC35267

Ingredient ID: NPC34490

Ingredient ID: NPC33702

Ingredient ID: NPC33541

Ingredient ID: NPC327013

Ingredient ID: NPC317474

Ingredient ID: NPC31563

Ingredient ID: NPC304433

Ingredient ID: NPC300017

Ingredient ID: NPC294625

Ingredient ID: NPC291027

Ingredient ID: NPC291010

Ingredient ID: NPC290648

Ingredient ID: NPC290421

Ingredient ID: NPC287047

Ingredient ID: NPC280210

Ingredient ID: NPC276779

Ingredient ID: NPC267466

Ingredient ID: NPC26523

Ingredient ID: NPC263345

Ingredient ID: NPC255452

Ingredient ID: NPC254327

Ingredient ID: NPC250664

Ingredient ID: NPC249660

Ingredient ID: NPC248142

Ingredient ID: NPC247553

Ingredient ID: NPC247409

Ingredient ID: NPC236947

Ingredient ID: NPC234378

Ingredient ID: NPC233910

Ingredient ID: NPC230

Ingredient ID: NPC22766

Ingredient ID: NPC223800

Ingredient ID: NPC220528

Ingredient ID: NPC220509

Ingredient ID: NPC215078

Ingredient ID: NPC212670

Ingredient ID: NPC211401

Ingredient ID: NPC209997

Ingredient ID: NPC209773

Ingredient ID: NPC208068

Ingredient ID: NPC206264

Ingredient ID: NPC204385

Ingredient ID: NPC20400

Ingredient ID: NPC203064

Ingredient ID: NPC202113

Ingredient ID: NPC201214

Ingredient ID: NPC200302

Ingredient ID: NPC193180

Ingredient ID: NPC191830

Ingredient ID: NPC191074

Ingredient ID: NPC190558

Ingredient ID: NPC181162

Ingredient ID: NPC178263

Ingredient ID: NPC176599

Ingredient ID: NPC175943

Ingredient ID: NPC173031

Ingredient ID: NPC172786

Ingredient ID: NPC172596

Ingredient ID: NPC172518

Ingredient ID: NPC171850

Ingredient ID: NPC171551

Ingredient ID: NPC169485

Ingredient ID: NPC164516

Ingredient ID: NPC164378

Ingredient ID: NPC157878

Ingredient ID: NPC151003

Ingredient ID: NPC15039

Ingredient ID: NPC140302

Ingredient ID: NPC132923

Ingredient ID: NPC131969

Ingredient ID: NPC131058

Ingredient ID: NPC127590

Ingredient ID: NPC125131

Ingredient ID: NPC117351

Ingredient ID: NPC116631

Ingredient ID: NPC111275