CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Spiraea Japonica

Example Image

PLANiTS DNA barcode

Click for details-----ITS

GGAGGACATTGTCGAACCTGCCTAGCAGAACGACCCGAGAACCGATTTATAAATGACCCCTCATCCCGCGTGGTAGCGGCCGCGCGCGTTCGCTCGTCTCCTTGCGGGACTCGCTGCGCGCGCTCCGTCTTCCGCTGCGGGGGTACAAACGAAAACCGGCGCGAACCGCGCCAAGGAACCCTAAACGAATAGGCGCGCTCCCGCGAGCCCCGGAAGCGGTGCGCGGACGGGCAGCGTCGCCGAATTCATTACTATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGCCGTTGCCCCCCCGCGCCCTCCTCCTGGGAGAGACCGCGGGGGGACTGATGATGGCCTCCCGTGCGCTCCGCCGCGCGGTTGGCCCAAATACCGAGTCCCCGGCGACGTGCGCCACGACGATCGGTGGTTGAGAGACCTCTGTCGCAAGTCGTGCGCGCCCGTCGCGTCACGCGGGCTCGCATAGCGCAGCGCGCCGCACCCTGTGCGGAGCTTCCAACGCGACCCCA

Click for details-----ITS1

Click for details-----ITS2

GCCGTTGCCCCCCCGCGCCCTCYYYYTKGGAGYGAMCGCGGGGSGGRCTGATGATGGCCTCCCGTGCGCTCCGCCGCGCGGTTGGCCCAAATACCGAGTCCCCGGCGACGTGBGCCMCGACGATCGGKGGTTGARAGACCTCTGTCGCAAGTCGTGCSCGCCCGTCGCGTCACGCGGDCTCGCWYAVCGCCBCGCGMYGCACSYAGTGCGGAGCTTYCAACGCGACCCCA

Taxonomic Information

Plant ID: NPO6485
Plant Latin Name: Spiraea Japonica
Taxonomy Genus: Spiraea
Taxonomy Family: Rosaceae

Plant External Links:

NCBI TaxonomyDB: 309823
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:

China

Traditional Medicine System:

TCM

Geographical Distribution

China

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

19 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

17 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

8 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC99374

Ingredient ID: NPC7987

Ingredient ID: NPC74749

Ingredient ID: NPC477963

Ingredient ID: NPC300596

Ingredient ID: NPC298093

Ingredient ID: NPC284743

Ingredient ID: NPC273959

Ingredient ID: NPC264571

Ingredient ID: NPC254416

Ingredient ID: NPC243214

Ingredient ID: NPC231893

Ingredient ID: NPC209389

Ingredient ID: NPC208956

Ingredient ID: NPC190141

Ingredient ID: NPC180340

Ingredient ID: NPC165549

Ingredient ID: NPC110233

Ingredient ID: NPC103522

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 2	CYP2D6	Cytochrome P450 2D6	P10635	CHEMBL289
Therapeutic Target	Methyl-lysine/arginine binding protein	SMN1	Survival motor neuron protein	Q16637	CHEMBL1293232
Therapeutic Target	Other cytosolic protein	MAPT	Microtubule-associated protein tau	P10636	CHEMBL1293224
Therapeutic Target	Oxidoreductase	ND4	NADH-ubiquinone oxidoreductase chain 4	P03905	CHEMBL4499
Therapeutic Target	Phosphodiesterase	TDP1	Tyrosyl-DNA phosphodiesterase 1	Q9NUW8	CHEMBL1075138
Therapeutic Target	Protein Kinase	MTOR	Serine/threonine-protein kinase mTOR	P42345	CHEMBL2842
Therapeutic Target	Protein Kinase	GSK3B	Glycogen synthase kinase-3 beta	P49841	CHEMBL262
Therapeutic Target	Small molecule receptor (family A GPCR)	HTR6	Serotonin 6 (5-HT6) receptor	P50406	CHEMBL3371
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235
Therapeutic Target	Unclassified protein	PMP22	Peripheral myelin protein 22	Q01453	CHEMBL1293298

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	9

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT01901705	A Study of Topical Indigo Naturalis Treatment in Patients With Mild to Moderate Plaque-type Psoriasis	psoriasis	Indigo (NPC209389)	NP level
NCT02899169	Treatment of Non-high-risk Acute Promyelocytic Leukemia (APL) With Realgar-Indigo Naturalis Formula (RIF)	acute promyelocytic leukemia	Indigo (NPC209389)	NP level
NCT05297123	Treatment of Acute Myeloid Leukemia With Arsenic and All-trans Retinoid Acid	acute myeloid leukemia	Indigo (NPC209389)	NP level
NCT01022502	Comparison of Refined and Crude Indigo Naturalis Ointment in Treating Psoriasis	psoriasis vulgaris	Indigo (NPC209389)	NP level
NCT01445886	Comparison of Indigo Naturalis Oil Extract and Calcipotriol Solution in Treating Psoriasis	psoriasis	Indirubin (NPC300596)	NP level
NCT00622440	Treatment of Anal High-grade Squamous Intraepithelial Lesions (HSIL) Through Use of a Chinese Herbal Topical Cream	anal neoplasm	Indigo (NPC209389)	NP level
NCT02088281	Mechanistic Study of Indigo Naturalis in Treating Psoriasis	psoriasis vulgaris	Indirubin (NPC300596)	NP level
NCT02669888	Indigo Naturalis in Treating Atopic Dermatitis Topically	atopic eczema	Indigo (NPC209389)	NP level
NCT00999687	Evaluation of the Efficacy and Safety of Indigo Naturalis Oil Extract on Psoriatic Nails	psoriasis	Indirubin (NPC300596)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	NCT00999687,NCT02088281,NCT01445886,NCT01022502,NCT01901705
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	SMN1,TDP1,PMP22,CDK2,LMNA
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	TDP1,SMN1,CDK2,LMNA
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	HTR6,GSK3B,MAPT
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	MTOR,CDK2,GSK3B
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	MAPT,GSK3B NCT05297123
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	PMP22,MAPT,LMNA
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	PMP22,LMNA,CYP2C19
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	PMP22,CDK2,LMNA
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	MAPT,HTR6
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	MAPT,HTR6
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	CDK2,MTOR
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	CDK2,MTOR
Muscular atrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B61	SMN2,SMN1
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	MTOR,CDK2
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	MTOR,CDK2
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	TDP1,HTR6
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	TDP1,HTR6
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	HTR6,MAPT
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	MAPT,MAPT
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	HTR6,CYP2C19
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	HTR6,CYP2D6
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	SMN1,CDK2
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	HTR6
Malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F40-1F45	CYP2D6
Thymoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	CDK2
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	MTOR
Myeloproliferative neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A20	GSK3B
Chronic myelomonocytic leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A40	MTOR
Transplant rejection Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE84	MTOR
Myotonic disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71	GSK3B
Liver cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12	MTOR
Nasopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6B	CDK2
Pleomorphic sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B54	MTOR
Obesity Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B80-5B81	HTR6
Choreiform disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A01	MAPT
Neurodegenerative disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20-8A23	HTR6
Endometrial cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76	MTOR
Anxiety Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB24.3	HTR6
Fragile X chromosome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD55	GSK3B
Lymphangioleiomyomatosis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB07	MTOR
Malignant mesenchymal neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5D-2B5Y	MTOR
Insomnia Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7A0Z	CYP2D6
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	MTOR
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	MTOR
Pleural mesothelioma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26	MTOR
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	CDK2
Metastatic lymph node neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60	MTOR
Dissociative neurological symptom disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6B60	HTR6
Non-small cell lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	CDK2
Arteries/arterioles disorder Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD52	MTOR
Bladder cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94	MTOR
Osteosarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B51	GSK3B
Head and neck cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D42	MTOR
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	MTOR
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	MTOR
Hydrocephalus Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8D64	MTOR
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	MTOR
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	NCT02669888
Acute promyelocytic leukaemia Disease Category: X.Extension Codes Disease ICD-11 Code: XH1A50	NCT02899169
Malignant neoplasms of anus or anal canal Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C00	NCT00622440
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	PMP22
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	HTR6
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	CYP2D6
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	LMNA
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	MAPT
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	LMNA
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	HTR6
Gliomas of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.0	CDK2

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Spiraea Japonica

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

19 All known Ingredients in Total

17 Ingredients with Acceptable Bioavailablity

8 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Psoriasis

Diffuse large B-cell lymphomas

Mesothelioma of pleura

Parkinsonism

Solid tumour/cancer

Acute myeloid leukaemia

Malignant neoplasms of biliary tract, distal bile duct

Adenocarcinoma of pancreas

Superficial ovarian endometriosis

Alzheimer disease

Mild neurocognitive disorder

Malignant haematopoietic neoplasm

Lung cancer

Muscular atrophy

Mature T-cell lymphoma

Breast cancer

Carcinosarcoma of uterus

Serous cystadenoma,borderline malignancy of ovary

Pheochromocytoma

Hepatocellular carcinoma of liver

Cytomegaloviral disease

Malignant neoplasms of corpus uteri, unspecified

Germ cell tumour of testis

Schizophrenia

Malaria

Thymoma

Renal cell carcinoma

Myeloproliferative neoplasm

Chronic myelomonocytic leukaemia

Transplant rejection

Myotonic disorder

Liver cancer

Nasopharyngeal cancer

Pleomorphic sarcoma

Obesity

Choreiform disorder

Neurodegenerative disorder

Endometrial cancer

Anxiety

Fragile X chromosome

Lymphangioleiomyomatosis

Malignant mesenchymal neoplasm

Insomnia

Pancreatic cancer

Prostate cancer

Pleural mesothelioma

Brain cancer

Metastatic lymph node neoplasm

Dissociative neurological symptom disorder

Non-small cell lung cancer

Arteries/arterioles disorder

Bladder cancer

Osteosarcoma

Head and neck cancer

Pulmonary hypertension

Pain, unspecified

Hydrocephalus

Multiple myeloma

Atopic eczema

Acute promyelocytic leukaemia

Malignant neoplasms of anus or anal canal

Hepatoblastoma