• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Eupatorium Cannabinum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAACCCTGGATGGCAAAACAACCCGTGAACGTGTATCAACAATATGGCTTGGCGGGTACCGAAGCTTCTTGTTTCAATCCCTGTGAAGCCCTGTCGACGTGCGCTTGTGGCGTGTCTTTTCGGCACTCACGGCATCACGTTGACGCAACAACAACCCCCGGCACAGCACGTGCCAAGGAAAACCAAACTTAAGAGCGTCCGTGCCATGACGCCCCGTGCTAGGTGTGTTCNTGGTATGCGGCTTCTTTGTAATTCTAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCACCCGGCTGAGGGCACGTCTGCCTGGGCGTCACGCATCACGTCGCCCACATCAAACATCCATGATGTATGTGGGCGGAGACTGGTCTCCCGTGCCCATGGTGCGGTTGGCCCAAATACGAGTCCGTTTAAGGGTGACGCACGACTGGTGGTGGTTGATTACACAGTCGTCTCGTGTCGTGGGTCTCGATTCTTGACGGTATGGCTCTTGTAGTACCCTAATGCGTCGTCTTGTGATGGCTCTTCGATC

Click for details-----ITS1

TCGAACCCTGGATGGCAAAACAACCCGTGAACGTGTATCAACAATATGGCTTGGCGGGTACCGAAGCTTCTTGTTTCAATCCCTGTGAAGCCCTGTCGACGTGCGCTTGTGGCGTGTCTTTTCGGCACTCACGGCATCACGTTGACGCAACAACAACCCCCGGCACAGCACGTGCCAAGGAAAACCAAACTTAAGAGCGTCCGTGCCATGACGCCCCGTGCTAGGTGTGTTCNTGGTATGCGGCTTCTTTGTAATTCTAAA

Click for details-----ITS2

ATCACGTCGCCCACATCAAACATCCATGATGTATGTGGGCGGAGACTGGTCTCCCGTGCCCATGGTGCGGTTGGCCCAAATACGAGTCCGTTTAAGGGTGACGCACGACTGGTGGTGGTTGATTACACAGTCGTCTCGTGTCGTGGGTCTCGATTCTTGACGGTATGGCTCTTGTAGTACCCTAATGCGTCGTCTTGTGATGGCTCTTCGATC
Taxonomic Information

Plant ID: NPO6414
Plant Latin Name: Eupatorium Cannabinum
Taxonomy Genus: Eupatorium
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 102770
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Lebanon; Italy; China; India

Traditional Medicine System:
Indian Folk; TCM


Medicinal Functions:

Alterative; Antitumor; Cholagogue; Depurative; Diaphoretic; Diuretic; Emetic; Expectorant; Febrifuge; Homeopathy; Laxative; Purgative; Tonic

Geographical Distribution

Lebanon; India; Italy; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

60 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


55 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

31 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98748

Ingredient ID: NPC96192

Ingredient ID: NPC93803

Ingredient ID: NPC89961

Ingredient ID: NPC84868

Ingredient ID: NPC84488

Ingredient ID: NPC84379

Ingredient ID: NPC81854

Ingredient ID: NPC77206

Ingredient ID: NPC71786

Ingredient ID: NPC63177

Ingredient ID: NPC49151

Ingredient ID: NPC488120

Ingredient ID: NPC488119

Ingredient ID: NPC488118

Ingredient ID: NPC488117

Ingredient ID: NPC488116

Ingredient ID: NPC48657

Ingredient ID: NPC480239

Ingredient ID: NPC46814

Ingredient ID: NPC44449

Ingredient ID: NPC41851

Ingredient ID: NPC41567

Ingredient ID: NPC329272

Ingredient ID: NPC328485

Ingredient ID: NPC327070

Ingredient ID: NPC325301

Ingredient ID: NPC324488

Ingredient ID: NPC322569

Ingredient ID: NPC31723

Ingredient ID: NPC310692

Ingredient ID: NPC298801

Ingredient ID: NPC298456

Ingredient ID: NPC289598

Ingredient ID: NPC28873

Ingredient ID: NPC28337

Ingredient ID: NPC273619

Ingredient ID: NPC26646

Ingredient ID: NPC26615

Ingredient ID: NPC257040

Ingredient ID: NPC234408

Ingredient ID: NPC231183

Ingredient ID: NPC230301

Ingredient ID: NPC22469

Ingredient ID: NPC211164

Ingredient ID: NPC20791

Ingredient ID: NPC204504

Ingredient ID: NPC201292

Ingredient ID: NPC190212

Ingredient ID: NPC183982

Ingredient ID: NPC183781

Ingredient ID: NPC174911

Ingredient ID: NPC161304

Ingredient ID: NPC139891

Ingredient ID: NPC122943

Ingredient ID: NPC11878

Ingredient ID: NPC114184

Ingredient ID: NPC113733

Ingredient ID: NPC106967

Ingredient ID: NPC101766