CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Phryma Leptostachya

Example Image

PLANiTS DNA barcode

Click for details-----ITS

AGGATCATTGTCGAAACCTGCAAAGCAGACCGCGAACACGTTTTAACCAATCGGGGACGCGGCGTGGGGTGAGAGCCTCCCGTCGCGGCCCCTCTCCCGCCGGTGAGCACTTGATTGCGAATCGTGCGGGCTAACGAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAATGAAGCACCTCCCTCCCGTCGCCTCGTTCGCGATGTGCGCGGGCGGGCGGGTGTCTCACGAATGTCATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACATCTGCCTGGGCGTCACGCATCGCGGCGTCCCCCTCCCCACTCCTCGAGTGCGGGCTGGGGGGCGGACAATGGCCTCCCGTTTGCCTCGGCTTGCGGCCGGCCCAAATGCGATCCCGCGGCGATGCATGTCACGAGCAGTGGTGGTTGAATACTCAACTCGCGTGCTGTCATGCTTGATGGCGTCGTCCGCTCGGGAGTCAATGATGACCCAACGGCGTGTCCAACGACGTGC

Click for details-----ITS1

Click for details-----ITS2

ATCGCGGCGTCCCCCTCCCCACTCCTCGAGGGCGGGCTGGGGGGCGGACAATGGCCTCCCGTTTGCCTCGGCTTGCGGCCGGCCCAAATGCGATCCCGCGGCGATGCATGTCACGAGCAGTGGTGGTTGAATACTCAACTCGCGTGCTGTCATGCTTGATGGCGTCGTCCGCTCGGGAGTCAATGATGACCCAACGGCGTGTCCAACGACGCGCCTTCGA

Taxonomic Information

Plant ID: NPO6371
Plant Latin Name: Phryma Leptostachya
Taxonomy Genus: Phryma
Taxonomy Family: Phrymaceae

Plant External Links:

NCBI TaxonomyDB: 41401
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

5 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

3 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

2 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC92111

Ingredient ID: NPC66843

Ingredient ID: NPC45613

Ingredient ID: NPC226896

Ingredient ID: NPC124638

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Small molecule receptor (family A GPCR)	HTR1A	Serotonin 1a (5-HT1a) receptor	P08908	CHEMBL214
Therapeutic Target	Small molecule receptor (family A GPCR)	MTNR1B	Melatonin receptor 1B	P49286	CHEMBL1946
Therapeutic Target	Small molecule receptor (family A GPCR)	MTNR1A	Melatonin receptor 1A	P48039	CHEMBL1945
Therapeutic Target	Small molecule receptor (family A GPCR)	HTR1D	Serotonin 1d (5-HT1d) receptor	P28221	CHEMBL1983
Therapeutic Target	Small molecule receptor (family A GPCR)	HTR7	Serotonin 7 (5-HT7) receptor	P34969	CHEMBL3155
Therapeutic Target	Small molecule receptor (family A GPCR)	HTR2B	Serotonin 2b (5-HT2b) receptor	P41595	CHEMBL1833
Therapeutic Target	Small molecule receptor (family A GPCR)	HTR6	Serotonin 6 (5-HT6) receptor	P50406	CHEMBL3371
Therapeutic Target	Small molecule receptor (family A GPCR)	HTR1B	Serotonin 1b (5-HT1b) receptor	P28222	CHEMBL1898
Therapeutic Target	Small molecule receptor (family A GPCR)	HTR2C	Serotonin 2c (5-HT2c) receptor	P28335	CHEMBL225
Therapeutic Target	Small molecule receptor (family A GPCR)	HTR2A	Serotonin 2a (5-HT2a) receptor	P28223	CHEMBL224

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	1

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT04698603	Clinical Study of GH001 in Depression	major depressive disorder;treatment resistant depression	5-Meo-Dmt (NPC92111)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	HTR2C,HTR7,HTR2A,HTR1D,MTNR1A,HTR6,HTR1B,HTR1A
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	HTR7,HTR1B,HTR2C,HTR2A,HTR6,HTR1A
Depression Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A70-6A7Z	HTR1A,HTR2B,HTR2A,HTR7,HTR2C NCT04698603
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	HTR2C,HTR7,HTR1A,HTR6,HTR2A,HTR1B
Attention deficit hyperactivity disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A05	HTR1A,HTR2B,HTR2C,HTR1B,HTR7,HTR2A
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	HTR1A,HTR7,HTR1D,HTR1B,HTR6,HTR2A
Insomnia Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7A0Z	HTR2A,MTNR1A,HTR1A,HTR1D,MTNR1B
Anxiety Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB24.3	HTR6,HTR2C,MTNR1A,HTR2A,HTR1A
Psychotic disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20-6A25	HTR2C,HTR1A,HTR2A,HTR1B,HTR2B
Pituitary gland disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A60-5A61	HTR2B,HTR2A,HTR1D,HTR1B,HTR2C
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	HTR7,HTR1D,HTR1B,HTR2B,HTR2A
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	HTR2C,HTR1D,MTNR1B,HTR1D,MTNR1B
Migraine Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A80	HTR1D,HTR2C,HTR1A,HTR1B
Mood disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A60-6E23	HTR2A,HTR1A,HTR1B,HTR1D
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	HTR1D,HTR1A,MTNR1A,HTR2A
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	HTR7,HTR1D,HTR2C,HTR6
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	HTR7,HTR1D,HTR2A,HTR1B
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	MTNR1A,HTR2C,HTR1D,HTR2B
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	HTR1A,HTR2C,HTR1B
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	HTR7,HTR6,HTR1A
Bipolar disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A60	HTR1A,HTR7,HTR2A
Tonus and reflex abnormality Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB47	HTR1B,HTR2C,HTR1A
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	HTR1D,HTR2C,HTR6
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	HTR2C,HTR7,HTR1D
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	HTR1D,HTR7,HTR6
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	HTR2C,HTR7,MTNR1A
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	HTR7,HTR1D,HTR6
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	HTR7,HTR2C,HTR2A
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	HTR1D,HTR1B,HTR2C
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	HTR2B,HTR6,HTR2A
Chronic insomnia Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00	HTR2A,HTR2C
Epilepsy/seizure Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A61-8A6Z	HTR1D,MTNR1B
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	HTR2A,HTR2C
Circadian rhythm sleep disorder Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A60-7A65	MTNR1A,MTNR1B
Sleep-wake disorder Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7B2Z	HTR2C,HTR2A
Social anxiety disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6B04	HTR1A,HTR2A
Sexual dysfunction Disease Category: 17.Conditions related to sexual health Disease ICD-11 Code: HA00-HA01	HTR2A,HTR1A
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	HTR1A HTR7
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	HTR2B,HTR1A
Obesity Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B80-5B81	HTR6,HTR2C
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	HTR1D,HTR1B
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	HTR2C,HTR1D
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	HTR2C,HTR1D
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	MTNR1A,HTR1D
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	MTNR1B,HTR2C
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	HTR2C,HTR6
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	HTR2C,HTR1D
Intellectual development disorder Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD90	HTR1A
Idiopathic interstitial pneumonitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03	HTR2A
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	HTR2A
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	HTR2C
Dissociative neurological symptom disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6B60	HTR6
Ejaculatory dysfunction Disease Category: 17.Conditions related to sexual health Disease ICD-11 Code: HA03	HTR1A
Coronary atherosclerosis Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA80	HTR1A
Skin/mucosal anomaly Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD27	HTR1A
Schizoaffective disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A21	HTR2A
Bulimia nervosa Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6B81	HTR1A
Post-traumatic stress disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6B40	HTR2A
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	HTR2A
Muscular atrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B61	HTR1A
Cerebral ischaemia Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B1Z	HTR2A
Psychoactive substances use disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C4G	HTR2C
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	HTR2C
Postoperative inflammation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-CA43	HTR1A
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	HTR2A
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	HTR2A
Neurodegenerative disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20-8A23	HTR6
Juvenile idiopathic arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA24	HTR1A
Hypoactive sexual desire dysfunction Disease Category: 17.Conditions related to sexual health Disease ICD-11 Code: HA00	HTR1A
Chronic pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG30	HTR2A
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	HTR2A
Single episode depressive disorder, severe, without psychotic symptoms Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A70.3	NCT04698603
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	HTR1D
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	HTR7
Idiopathic pulmonary fibrosis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03.4	HTR2A
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	HTR2C
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	HTR2B
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	HTR2C
Chronic rhinosinusitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA0A	MTNR1A
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	HTR1D
Heart failure, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD1Z	HTR2A
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	HTR2C

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Phryma Leptostachya

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

5 All known Ingredients in Total

3 Ingredients with Acceptable Bioavailablity

2 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Alzheimer disease

Parkinsonism

Depression

Schizophrenia

Attention deficit hyperactivity disorder

Pheochromocytoma

Insomnia

Anxiety

Psychotic disorder

Pituitary gland disorder

Adenocarcinoma of pancreas

Hepatocellular carcinoma of liver

Migraine

Mood disorder

Dementia

Carcinosarcoma of uterus

Mesothelioma of pleura

Adenocarcinoma of bronchus or lung

Malignant haematopoietic neoplasm

Mild neurocognitive disorder

Bipolar disorder

Tonus and reflex abnormality

Serous cystadenoma,borderline malignancy of ovary

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Other specified malignant neoplasms of kidney, except renal pelvis

Squamous cell carcinoma of bronchus or lung

Cytomegaloviral disease

Malignant neoplasms of thymus

Germ cell tumour of testis

Carpal tunnel syndrome

Chronic insomnia

Epilepsy/seizure

Acute diabete complication

Circadian rhythm sleep disorder

Sleep-wake disorder

Social anxiety disorder

Sexual dysfunction

Psoriasis

Pulmonary hypertension

Obesity

Hepatoblastoma

Other specified malignant neoplasms ofcolon

Melanoma of skin

Malignant neoplasms of oesophagus

Urothelial carcinoma of bladder

Malignant neoplasms of corpus uteri, unspecified

Invasive carcinoma of breast

Intellectual development disorder

Idiopathic interstitial pneumonitis

Cardiovascular disease

Substance abuse

Dissociative neurological symptom disorder

Ejaculatory dysfunction

Coronary atherosclerosis

Skin/mucosal anomaly

Schizoaffective disorder

Bulimia nervosa

Post-traumatic stress disorder

Glaucoma

Muscular atrophy

Cerebral ischaemia

Psychoactive substances use disorder

Pain, unspecified

Postoperative inflammation