• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Frasera Caroliniensis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGCGTCGCCCCCCCAAACCCGTTTGTTAAGTCCTACGGGTGAGATGAGGGGACGGAAATTGGCTTCCCGTGCCCGTTCGCGGCTGGCCTAAATGTGAGTCCCTTGCGAAGGACGCGACGACAAGTGGTGGTTGATTGCTCAACTAAGGTGCTGTCGAGCGCTGTTCGTCGATTGAGGAGACTCCCCGACCCTGATGCATGCGCCGTCATGATGCATGCTACGA
Taxonomic Information

Plant ID: NPO6284
Plant Latin Name: Frasera Caroliniensis
Taxonomy Genus: Frasera
Taxonomy Family: Gentianaceae

Plant External Links:

NCBI TaxonomyDB: 485363
Plant-of-the-World-Online: 367672-1

Used in Medicines

Unknown.

Geographical Distribution

Canada; United States; Georgia

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

23 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


17 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

8 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC82979

Ingredient ID: NPC78326

Ingredient ID: NPC64419

Ingredient ID: NPC51781

Ingredient ID: NPC48945

Ingredient ID: NPC40552

Ingredient ID: NPC311100

Ingredient ID: NPC282169

Ingredient ID: NPC264317

Ingredient ID: NPC263049

Ingredient ID: NPC25864

Ingredient ID: NPC252604

Ingredient ID: NPC246882

Ingredient ID: NPC245773

Ingredient ID: NPC230301

Ingredient ID: NPC220189

Ingredient ID: NPC177003

Ingredient ID: NPC173888

Ingredient ID: NPC168999

Ingredient ID: NPC159362

Ingredient ID: NPC146679

Ingredient ID: NPC136313

Ingredient ID: NPC11107