• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Dahlstedtia Araripensis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGTTGTCCCAACGCCAATGCCGACCTAACAAGGCGTTGTCGGGGGCGAATGTTGACCTCCCGCAAGCACCGCCTTGCGGTTGGTTGAAAAACGAGTCCTCCGTGGAGAGCCCCATGATAAATGGTGGTTGAGCNACCCTCGAGACCAATCATGTGCGGCCCTTCCCCGTGCGCGGCTCACGCGACCCTTGCGTTCCCCGGAACGCTCATA
Taxonomic Information

Plant ID: NPO6157
Plant Latin Name: Dahlstedtia Araripensis
Taxonomy Genus: Dahlstedtia
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 1457503
Plant-of-the-World-Online: 77118413-1

Used in Medicines

Unknown.

Geographical Distribution

Brazil; Bolivia

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

32 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


13 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

22 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC95594

Ingredient ID: NPC92117

Ingredient ID: NPC90829

Ingredient ID: NPC85694

Ingredient ID: NPC83670

Ingredient ID: NPC74595

Ingredient ID: NPC51700

Ingredient ID: NPC49627

Ingredient ID: NPC49599

Ingredient ID: NPC42853

Ingredient ID: NPC40702

Ingredient ID: NPC30583

Ingredient ID: NPC304741

Ingredient ID: NPC29883

Ingredient ID: NPC289196

Ingredient ID: NPC281131

Ingredient ID: NPC270689

Ingredient ID: NPC264317

Ingredient ID: NPC263548

Ingredient ID: NPC253662

Ingredient ID: NPC239966

Ingredient ID: NPC225723

Ingredient ID: NPC225710

Ingredient ID: NPC225616

Ingredient ID: NPC20791

Ingredient ID: NPC178383

Ingredient ID: NPC178134

Ingredient ID: NPC169749

Ingredient ID: NPC139546

Ingredient ID: NPC127684

Ingredient ID: NPC121171

Ingredient ID: NPC107775