• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Salvia Officinalis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

AAACCTGCAAAGCAGACCGCGAACACGTGACTAACACCGACCGACGGTGCATGGCGTGGGGGCGACCCCCGTCCTGTTCCCGTCACCCCCGCCCGCGTGCTCCCATCGGGTCACGTCGTGCGGGCTAACGAACCCCGGCGCGGAATGCGCCAAGGAAAACCAAACGAAGCATCSTCCCCCCGCGCCCCGTTCGCGGAGTGTGCGGGGGCGWCGGATGTCTATCAAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCCCACCGTGCGCACAGCGCCCGCTGTGGGGGGGCGGATATTGGCCTCCCGTGCTCCTCGGCGTGCGGCTGGCCCAAATGCGATCCCTCGGCGACTCATGTCACGACAAGTGGTGGTTGAACAACTCAATCTCGCGCGCCGTCGTGCCACTGCGTCGTCCGCTTGGGCATCCATCAACGACCCAAGGTGCCGGTGCCTCGCAGCACCCACCTTCGACCGCGACCCCAGGTCAGGCGGGATC

Click for details-----ITS1

GTGAACCTGCGGAAGGATCATTGTCGAAACCTGCAAAGCAGACCGCGAACACNTGACTAACACCGACCGACGGTGCATGGCGTGGGGGCGACCCCCGTCCTGTTCCCGTCACCCCCGCCCGCGTGCTCCCATCGGGTCACGTCGTGCGGGCTAACGAACCCCGGCGCGGAATGCGCCAAGGAAAACCAAACGAAGCATCCTCCCCCCGCGCCCCGTTCGCGGAGTGTGCGGGGGCGTCGGATGTCTATCAAATGTCAAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO6098
Plant Latin Name: Salvia Officinalis
Taxonomy Genus: Salvia
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 38868
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Italy; South Africa; India; China; Chile; Switzerland; Argentina; Spain

Traditional Medicine System:
TCM; Homeopathy; Siddha


Medicinal Functions:

Antidiarrhoeal; Antihydrotic; Antiseptic; Antispasmodic; Appetizer; Aromatherapy; Astringent; Carminative; Cholagogue; Galactofuge; Stimulant; Tonic; Vasodilator

Geographical Distribution

Italy; South Africa; India; China; Chile; Switzerland; Argentina; Spain

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

248 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


189 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

134 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99734

Ingredient ID: NPC99088

Ingredient ID: NPC95704

Ingredient ID: NPC95031

Ingredient ID: NPC94167

Ingredient ID: NPC92085

Ingredient ID: NPC92080

Ingredient ID: NPC91931

Ingredient ID: NPC90040

Ingredient ID: NPC88566

Ingredient ID: NPC87828

Ingredient ID: NPC86951

Ingredient ID: NPC86545

Ingredient ID: NPC85813

Ingredient ID: NPC85233

Ingredient ID: NPC84786

Ingredient ID: NPC83187

Ingredient ID: NPC81010

Ingredient ID: NPC79416

Ingredient ID: NPC79056

Ingredient ID: NPC78551

Ingredient ID: NPC76145

Ingredient ID: NPC72141

Ingredient ID: NPC69394

Ingredient ID: NPC68889

Ingredient ID: NPC66655

Ingredient ID: NPC65959

Ingredient ID: NPC63872

Ingredient ID: NPC61

Ingredient ID: NPC58752

Ingredient ID: NPC57605

Ingredient ID: NPC55412

Ingredient ID: NPC53403

Ingredient ID: NPC51700

Ingredient ID: NPC50898

Ingredient ID: NPC50715

Ingredient ID: NPC50701

Ingredient ID: NPC49151

Ingredient ID: NPC490331

Ingredient ID: NPC490146

Ingredient ID: NPC490039

Ingredient ID: NPC490038

Ingredient ID: NPC489907

Ingredient ID: NPC47781

Ingredient ID: NPC473924

Ingredient ID: NPC473867

Ingredient ID: NPC47255

Ingredient ID: NPC46801

Ingredient ID: NPC45782

Ingredient ID: NPC45727

Ingredient ID: NPC4455

Ingredient ID: NPC40818

Ingredient ID: NPC38497

Ingredient ID: NPC3649

Ingredient ID: NPC34764

Ingredient ID: NPC330957

Ingredient ID: NPC320443

Ingredient ID: NPC32021

Ingredient ID: NPC31290

Ingredient ID: NPC312800

Ingredient ID: NPC311810

Ingredient ID: NPC311529

Ingredient ID: NPC307168

Ingredient ID: NPC306993

Ingredient ID: NPC306397

Ingredient ID: NPC306296

Ingredient ID: NPC305016

Ingredient ID: NPC301696

Ingredient ID: NPC29883

Ingredient ID: NPC297306

Ingredient ID: NPC29710

Ingredient ID: NPC297054

Ingredient ID: NPC296473

Ingredient ID: NPC29536

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC293454

Ingredient ID: NPC291001

Ingredient ID: NPC290598

Ingredient ID: NPC288756

Ingredient ID: NPC287331

Ingredient ID: NPC285814

Ingredient ID: NPC282363

Ingredient ID: NPC281385

Ingredient ID: NPC279865

Ingredient ID: NPC279121

Ingredient ID: NPC279026

Ingredient ID: NPC278023

Ingredient ID: NPC277917

Ingredient ID: NPC277385

Ingredient ID: NPC27657

Ingredient ID: NPC273756

Ingredient ID: NPC27184

Ingredient ID: NPC270549

Ingredient ID: NPC269919

Ingredient ID: NPC26906

Ingredient ID: NPC268647

Ingredient ID: NPC266371

Ingredient ID: NPC2660

Ingredient ID: NPC265305

Ingredient ID: NPC263265

Ingredient ID: NPC262505

Ingredient ID: NPC261991

Ingredient ID: NPC261831

Ingredient ID: NPC259512

Ingredient ID: NPC259105

Ingredient ID: NPC257716

Ingredient ID: NPC257188

Ingredient ID: NPC255350

Ingredient ID: NPC25270

Ingredient ID: NPC252074

Ingredient ID: NPC251666

Ingredient ID: NPC249815

Ingredient ID: NPC249164

Ingredient ID: NPC248404

Ingredient ID: NPC247844

Ingredient ID: NPC2476

Ingredient ID: NPC246165

Ingredient ID: NPC245807

Ingredient ID: NPC243925

Ingredient ID: NPC242881

Ingredient ID: NPC242580

Ingredient ID: NPC241784

Ingredient ID: NPC241498

Ingredient ID: NPC240504

Ingredient ID: NPC239039

Ingredient ID: NPC236705

Ingredient ID: NPC235625

Ingredient ID: NPC233209

Ingredient ID: NPC232375

Ingredient ID: NPC230301

Ingredient ID: NPC227325

Ingredient ID: NPC226973

Ingredient ID: NPC225710

Ingredient ID: NPC224517

Ingredient ID: NPC223573

Ingredient ID: NPC223110

Ingredient ID: NPC222781

Ingredient ID: NPC221743

Ingredient ID: NPC22098

Ingredient ID: NPC220615

Ingredient ID: NPC219738

Ingredient ID: NPC219677

Ingredient ID: NPC216919

Ingredient ID: NPC216630

Ingredient ID: NPC215932

Ingredient ID: NPC215632

Ingredient ID: NPC214285

Ingredient ID: NPC213749

Ingredient ID: NPC212819

Ingredient ID: NPC212511

Ingredient ID: NPC209970

Ingredient ID: NPC205959

Ingredient ID: NPC205522

Ingredient ID: NPC202977

Ingredient ID: NPC202189

Ingredient ID: NPC201844

Ingredient ID: NPC201547

Ingredient ID: NPC201057

Ingredient ID: NPC196832

Ingredient ID: NPC196439

Ingredient ID: NPC196021

Ingredient ID: NPC191184

Ingredient ID: NPC190771

Ingredient ID: NPC188261

Ingredient ID: NPC187770

Ingredient ID: NPC18351

Ingredient ID: NPC182840

Ingredient ID: NPC18205

Ingredient ID: NPC180871

Ingredient ID: NPC179831

Ingredient ID: NPC179540

Ingredient ID: NPC178383

Ingredient ID: NPC17810

Ingredient ID: NPC177148

Ingredient ID: NPC177112

Ingredient ID: NPC176819

Ingredient ID: NPC176775

Ingredient ID: NPC175987

Ingredient ID: NPC174360

Ingredient ID: NPC173996

Ingredient ID: NPC173695

Ingredient ID: NPC173295

Ingredient ID: NPC169407

Ingredient ID: NPC168855

Ingredient ID: NPC168602

Ingredient ID: NPC1682

Ingredient ID: NPC167815

Ingredient ID: NPC167400

Ingredient ID: NPC167010

Ingredient ID: NPC166894

Ingredient ID: NPC166362

Ingredient ID: NPC165651

Ingredient ID: NPC164964

Ingredient ID: NPC164487

Ingredient ID: NPC163556

Ingredient ID: NPC162050

Ingredient ID: NPC160961

Ingredient ID: NPC15912

Ingredient ID: NPC158824

Ingredient ID: NPC154480

Ingredient ID: NPC154176

Ingredient ID: NPC151620

Ingredient ID: NPC150950

Ingredient ID: NPC14958

Ingredient ID: NPC149184

Ingredient ID: NPC147983

Ingredient ID: NPC147723

Ingredient ID: NPC146165

Ingredient ID: NPC145379

Ingredient ID: NPC144023

Ingredient ID: NPC142860

Ingredient ID: NPC142415

Ingredient ID: NPC142366

Ingredient ID: NPC13991

Ingredient ID: NPC13933

Ingredient ID: NPC138932

Ingredient ID: NPC138867

Ingredient ID: NPC138397

Ingredient ID: NPC138360

Ingredient ID: NPC138113

Ingredient ID: NPC136014

Ingredient ID: NPC135238

Ingredient ID: NPC132428

Ingredient ID: NPC130683

Ingredient ID: NPC130577

Ingredient ID: NPC129680

Ingredient ID: NPC128726

Ingredient ID: NPC126707

Ingredient ID: NPC12664

Ingredient ID: NPC12509

Ingredient ID: NPC120253

Ingredient ID: NPC120163

Ingredient ID: NPC116994

Ingredient ID: NPC116502

Ingredient ID: NPC116315

Ingredient ID: NPC116260

Ingredient ID: NPC113733

Ingredient ID: NPC111888

Ingredient ID: NPC110899

Ingredient ID: NPC110639

Ingredient ID: NPC108663

Ingredient ID: NPC106157

Ingredient ID: NPC104323

Ingredient ID: NPC103711

Ingredient ID: NPC103213

Ingredient ID: NPC10286

Ingredient ID: NPC101294