• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Ziziphus Jujuba


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CGGAAGGATCATTGTCAAATCCTTGTACCGAATGACCCGCGAACACGTTCCGAAAAACGATAAGCGTTGTTGCGCCCTTGCTCGGGTCGGTCGGCGACTCAGTAATTATTTGTTGCCGGACGCGTCGAGCAGGGGACACGAAATCCGGCGCGGGAAGCGCCAAGGACTAGCAAACTAGAGGATGGCCTTCCCGCGGCACCAATCCTGGCCGCGGGGATTAAAGGGTCTCCAGAAAGAAAAATCTTATACGACTCTCGGCAACGGATATCTAGGCTCTCGCATCGATGAAGAACGTAGCAAACTGCGATAGTTGGTGTGAATTGCAGAATCCCGTGAACCATGGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATTGCGTCGTCCCCCCTCACCCGTGATGTCCTGAAAGGGGTCGCGGGCCTCAGCGTGGGGGCGGAAGTTGGCTTCCCGTGCAGTGTTTGCGGCTAGCCCGAAACGCGGCTCCCTCGCCGCGGACGTCGCGACAAGTGGTGGTCGTGGAGATTGTACGCGAGTTGCCGGCAAGCCGCGTCGAGGAGAGCCTTTTGGACCCCGTGCGAGATTTTTGAGTCCTTCACCGAGGGGCAATTCCAACGATTGCGACCCCTGGTCAGGC

Click for details-----ITS1

TTGAAACCTGCGCAGCAGAACAAGCAGCGAACCCGTGAATAACACATCGGGGACCCCGGGGCCCTGTGTCCCGGAGCCTTCCTTGGTCGGGGGTCTGCACCTCGCGCCTCGCCCGTCGATGCGCGGTTGCAGCCTTCCCGGCCGCACAAACGAACCCCGGCGCAAACCGCGCCAAGGAACACCTAACGAATTGGCATTCACCCCCCGCCCCGGAGACGGTGTGCGGTCGGGGTGCGCGTCGTATTCTCTATTGTAATGTCAAAA

Click for details-----ITS2

ATTGCGTCGTCCCCCCTCACCCGTGATGTCCTGAAAGGGGTCGCGGGCCTCAGCGTGGGGGCGGAAGTTGGCTTCCCGTGCAGTGTTTGCGGCTAGCCCGAAACGCGGCTCCCTCGCCGCGGACGTCGCGACAAGTGGTGGTCGTGGAGATTGTACGCGAGTTGCCGGCAAGCCGCGTCGAGGAGAGCCTTTTGGACCCCGTGCGAGATTTTTGAGTCCTTCACCGAGGGGCAATTCCAACGATTGCGACCCCTGGTCAGGC
Taxonomic Information

Plant ID: NPO5986
Plant Latin Name: Ziziphus Jujuba
Taxonomy Genus: Ziziphus
Taxonomy Family: Rhamnaceae

Plant External Links:

NCBI TaxonomyDB: 326968
Plant-of-the-World-Online: 719213-1

Used in Medicines

Country/Region:
Italy; India; Philippines; Lebanon; China; Jordan; Thailand; South Korea

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; TCM


Medicinal Functions:

Anodyne; Antidote; Astringent; Cancer; Diuretic; Emollient; Expectorant; Hypnotic; Narcotic; Pectoral; Poultice; Refrigerant; Sedative; Skin; Stomachic; Tonic

Geographical Distribution

Turkey; Italy; India; France; Cameroon; Burkina Faso; Algeria; Cuba; Venezuela; Jordan; China; Dominican Republic; Spain; Maldives; Libya; Philippines; United States; Morocco; Thailand; Bulgaria; Jamaica; Romania; Honduras; South Africa; Lebanon; Greece; South Korea

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

309 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


144 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

163 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99614

Ingredient ID: NPC99423

Ingredient ID: NPC9842

Ingredient ID: NPC97475

Ingredient ID: NPC96132

Ingredient ID: NPC95615

Ingredient ID: NPC9424

Ingredient ID: NPC94167

Ingredient ID: NPC91574

Ingredient ID: NPC90867

Ingredient ID: NPC89147

Ingredient ID: NPC88789

Ingredient ID: NPC88481

Ingredient ID: NPC86469

Ingredient ID: NPC85813

Ingredient ID: NPC84319

Ingredient ID: NPC81775

Ingredient ID: NPC81247

Ingredient ID: NPC81010

Ingredient ID: NPC80090

Ingredient ID: NPC7987

Ingredient ID: NPC79002

Ingredient ID: NPC78500

Ingredient ID: NPC76336

Ingredient ID: NPC75362

Ingredient ID: NPC7491

Ingredient ID: NPC72722

Ingredient ID: NPC71339

Ingredient ID: NPC71074

Ingredient ID: NPC70756

Ingredient ID: NPC70744

Ingredient ID: NPC70437

Ingredient ID: NPC66877

Ingredient ID: NPC66577

Ingredient ID: NPC6516

Ingredient ID: NPC62927

Ingredient ID: NPC61477

Ingredient ID: NPC61248

Ingredient ID: NPC61198

Ingredient ID: NPC60556

Ingredient ID: NPC59314

Ingredient ID: NPC58616

Ingredient ID: NPC56913

Ingredient ID: NPC56112

Ingredient ID: NPC54320

Ingredient ID: NPC5326

Ingredient ID: NPC52591

Ingredient ID: NPC51937

Ingredient ID: NPC51700

Ingredient ID: NPC50920

Ingredient ID: NPC49894

Ingredient ID: NPC486709

Ingredient ID: NPC486708

Ingredient ID: NPC486707

Ingredient ID: NPC486706

Ingredient ID: NPC486705

Ingredient ID: NPC486704

Ingredient ID: NPC486703

Ingredient ID: NPC486702

Ingredient ID: NPC486701

Ingredient ID: NPC486700

Ingredient ID: NPC486699

Ingredient ID: NPC486698

Ingredient ID: NPC486697

Ingredient ID: NPC486696

Ingredient ID: NPC486695

Ingredient ID: NPC47993

Ingredient ID: NPC478984

Ingredient ID: NPC44471

Ingredient ID: NPC43246

Ingredient ID: NPC424

Ingredient ID: NPC41326

Ingredient ID: NPC38002

Ingredient ID: NPC36108

Ingredient ID: NPC36061

Ingredient ID: NPC35627

Ingredient ID: NPC34995

Ingredient ID: NPC3357

Ingredient ID: NPC32977

Ingredient ID: NPC328788

Ingredient ID: NPC328740

Ingredient ID: NPC328443

Ingredient ID: NPC326445

Ingredient ID: NPC321355

Ingredient ID: NPC320443

Ingredient ID: NPC318997

Ingredient ID: NPC317480

Ingredient ID: NPC315603

Ingredient ID: NPC311110

Ingredient ID: NPC309311

Ingredient ID: NPC309182

Ingredient ID: NPC303729

Ingredient ID: NPC302857

Ingredient ID: NPC302778

Ingredient ID: NPC301696

Ingredient ID: NPC301585

Ingredient ID: NPC29883

Ingredient ID: NPC297033

Ingredient ID: NPC294902

Ingredient ID: NPC294881

Ingredient ID: NPC294548

Ingredient ID: NPC293628

Ingredient ID: NPC293580

Ingredient ID: NPC293378

Ingredient ID: NPC292953

Ingredient ID: NPC291375

Ingredient ID: NPC290349

Ingredient ID: NPC290319

Ingredient ID: NPC290078

Ingredient ID: NPC289774

Ingredient ID: NPC289758

Ingredient ID: NPC288537

Ingredient ID: NPC287876

Ingredient ID: NPC287331

Ingredient ID: NPC28366

Ingredient ID: NPC282781

Ingredient ID: NPC281245

Ingredient ID: NPC281131

Ingredient ID: NPC281128

Ingredient ID: NPC280213

Ingredient ID: NPC277400

Ingredient ID: NPC2770

Ingredient ID: NPC27699

Ingredient ID: NPC275312

Ingredient ID: NPC274384

Ingredient ID: NPC274052

Ingredient ID: NPC274050

Ingredient ID: NPC270946

Ingredient ID: NPC270136

Ingredient ID: NPC269440

Ingredient ID: NPC268673

Ingredient ID: NPC268221

Ingredient ID: NPC268129

Ingredient ID: NPC267691

Ingredient ID: NPC266880

Ingredient ID: NPC264711

Ingredient ID: NPC264317

Ingredient ID: NPC263334

Ingredient ID: NPC26316

Ingredient ID: NPC261831

Ingredient ID: NPC261619

Ingredient ID: NPC257124

Ingredient ID: NPC255662

Ingredient ID: NPC254700

Ingredient ID: NPC252433

Ingredient ID: NPC251619

Ingredient ID: NPC250436

Ingredient ID: NPC248056

Ingredient ID: NPC248029

Ingredient ID: NPC24772

Ingredient ID: NPC24751

Ingredient ID: NPC242641

Ingredient ID: NPC242580

Ingredient ID: NPC242203

Ingredient ID: NPC240528

Ingredient ID: NPC239037

Ingredient ID: NPC238254

Ingredient ID: NPC237837

Ingredient ID: NPC237532

Ingredient ID: NPC236709

Ingredient ID: NPC236202

Ingredient ID: NPC235059

Ingredient ID: NPC233731

Ingredient ID: NPC232926

Ingredient ID: NPC231738

Ingredient ID: NPC226840

Ingredient ID: NPC226705

Ingredient ID: NPC225710

Ingredient ID: NPC22535

Ingredient ID: NPC22484

Ingredient ID: NPC224076

Ingredient ID: NPC223697

Ingredient ID: NPC220498

Ingredient ID: NPC219876

Ingredient ID: NPC218109

Ingredient ID: NPC217713

Ingredient ID: NPC216630

Ingredient ID: NPC213935

Ingredient ID: NPC212848

Ingredient ID: NPC212551

Ingredient ID: NPC212549

Ingredient ID: NPC211162

Ingredient ID: NPC210849

Ingredient ID: NPC2108

Ingredient ID: NPC209970

Ingredient ID: NPC209846

Ingredient ID: NPC209525

Ingredient ID: NPC209275

Ingredient ID: NPC208674

Ingredient ID: NPC20791

Ingredient ID: NPC207326

Ingredient ID: NPC206800

Ingredient ID: NPC204932

Ingredient ID: NPC203784

Ingredient ID: NPC203440

Ingredient ID: NPC203171

Ingredient ID: NPC201844

Ingredient ID: NPC201562

Ingredient ID: NPC201431

Ingredient ID: NPC199362

Ingredient ID: NPC199123

Ingredient ID: NPC196776

Ingredient ID: NPC196119

Ingredient ID: NPC196042

Ingredient ID: NPC195749

Ingredient ID: NPC195537

Ingredient ID: NPC195395

Ingredient ID: NPC19503

Ingredient ID: NPC195019

Ingredient ID: NPC192744

Ingredient ID: NPC192402

Ingredient ID: NPC192173

Ingredient ID: NPC19044

Ingredient ID: NPC189737

Ingredient ID: NPC189724

Ingredient ID: NPC189266

Ingredient ID: NPC187770

Ingredient ID: NPC187738

Ingredient ID: NPC186793

Ingredient ID: NPC186653

Ingredient ID: NPC183950

Ingredient ID: NPC183485

Ingredient ID: NPC183374

Ingredient ID: NPC18335

Ingredient ID: NPC181465

Ingredient ID: NPC181153

Ingredient ID: NPC179950

Ingredient ID: NPC178134

Ingredient ID: NPC17810

Ingredient ID: NPC176740

Ingredient ID: NPC175987

Ingredient ID: NPC175913

Ingredient ID: NPC175342

Ingredient ID: NPC175313

Ingredient ID: NPC172990

Ingredient ID: NPC171736

Ingredient ID: NPC171280

Ingredient ID: NPC170526

Ingredient ID: NPC169468

Ingredient ID: NPC169222

Ingredient ID: NPC167976

Ingredient ID: NPC167400

Ingredient ID: NPC16728

Ingredient ID: NPC167103

Ingredient ID: NPC167038

Ingredient ID: NPC166752

Ingredient ID: NPC164700

Ingredient ID: NPC163105

Ingredient ID: NPC161881

Ingredient ID: NPC161659

Ingredient ID: NPC16157

Ingredient ID: NPC160122

Ingredient ID: NPC158306

Ingredient ID: NPC156654

Ingredient ID: NPC15658

Ingredient ID: NPC156461

Ingredient ID: NPC155263

Ingredient ID: NPC154573

Ingredient ID: NPC152964

Ingredient ID: NPC150540

Ingredient ID: NPC149184

Ingredient ID: NPC148464

Ingredient ID: NPC146197

Ingredient ID: NPC14337

Ingredient ID: NPC14330

Ingredient ID: NPC142753

Ingredient ID: NPC142703

Ingredient ID: NPC142415

Ingredient ID: NPC141762

Ingredient ID: NPC141040

Ingredient ID: NPC139029

Ingredient ID: NPC138886

Ingredient ID: NPC13789

Ingredient ID: NPC136087

Ingredient ID: NPC130683

Ingredient ID: NPC128635

Ingredient ID: NPC127343

Ingredient ID: NPC127341

Ingredient ID: NPC126759

Ingredient ID: NPC126029

Ingredient ID: NPC125304

Ingredient ID: NPC125144

Ingredient ID: NPC124478

Ingredient ID: NPC123474

Ingredient ID: NPC123381

Ingredient ID: NPC122493

Ingredient ID: NPC120649

Ingredient ID: NPC12053

Ingredient ID: NPC119949

Ingredient ID: NPC119743

Ingredient ID: NPC119386

Ingredient ID: NPC119107

Ingredient ID: NPC116146

Ingredient ID: NPC114992

Ingredient ID: NPC114627

Ingredient ID: NPC113665

Ingredient ID: NPC112701

Ingredient ID: NPC111888

Ingredient ID: NPC111547

Ingredient ID: NPC110899

Ingredient ID: NPC109813

Ingredient ID: NPC10807

Ingredient ID: NPC10781

Ingredient ID: NPC1075

Ingredient ID: NPC106250

Ingredient ID: NPC10269

Ingredient ID: NPC10241

Ingredient ID: NPC102167

Ingredient ID: NPC101285