• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Achlys Triphylla


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ACAGCGTCGCTCTCACCACAATATCTTTGAGTCTTTTATCAGACAAGAAGACTTGCGGTCGGGAAGCGGATATTGGCCCCCCGTGCCCTTGCAGGTGCGGTCGGCCCAAAACTTGGCCCTCGGTGACGAGTGTCACGATCAGTGGTGGTTGAATGACCCCTTCGTCGAATATCGGCATCGTGCTACCTCGTCGCCTTCTTGGGCCTATGGACCCTTGTCTGTCGTGTACACGACATTCACT
Taxonomic Information

Plant ID: NPO5981
Plant Latin Name: Achlys Triphylla
Taxonomy Genus: Achlys
Taxonomy Family: Berberidaceae

Plant External Links:

NCBI TaxonomyDB: 63345
Plant-of-the-World-Online: 106370-1

Used in Medicines

Unknown.

Geographical Distribution

Canada; United States

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

83 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


55 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

27 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9874

Ingredient ID: NPC92615

Ingredient ID: NPC90982

Ingredient ID: NPC90757

Ingredient ID: NPC89

Ingredient ID: NPC88806

Ingredient ID: NPC87213

Ingredient ID: NPC86438

Ingredient ID: NPC86249

Ingredient ID: NPC81803

Ingredient ID: NPC81010

Ingredient ID: NPC81002

Ingredient ID: NPC80600

Ingredient ID: NPC76356

Ingredient ID: NPC74351

Ingredient ID: NPC70744

Ingredient ID: NPC6984

Ingredient ID: NPC63973

Ingredient ID: NPC61461

Ingredient ID: NPC5586

Ingredient ID: NPC51570

Ingredient ID: NPC47094

Ingredient ID: NPC37468

Ingredient ID: NPC32163

Ingredient ID: NPC311986

Ingredient ID: NPC309557

Ingredient ID: NPC306244

Ingredient ID: NPC303409

Ingredient ID: NPC301377

Ingredient ID: NPC300017

Ingredient ID: NPC29883

Ingredient ID: NPC296427

Ingredient ID: NPC294470

Ingredient ID: NPC291454

Ingredient ID: NPC28983

Ingredient ID: NPC287992

Ingredient ID: NPC287301

Ingredient ID: NPC280077

Ingredient ID: NPC276808

Ingredient ID: NPC276268

Ingredient ID: NPC273070

Ingredient ID: NPC272695

Ingredient ID: NPC272537

Ingredient ID: NPC272415

Ingredient ID: NPC265007

Ingredient ID: NPC263417

Ingredient ID: NPC263367

Ingredient ID: NPC258546

Ingredient ID: NPC251102

Ingredient ID: NPC248355

Ingredient ID: NPC245561

Ingredient ID: NPC24402

Ingredient ID: NPC241105

Ingredient ID: NPC235431

Ingredient ID: NPC228346

Ingredient ID: NPC227698

Ingredient ID: NPC227678

Ingredient ID: NPC227302

Ingredient ID: NPC219913

Ingredient ID: NPC214702

Ingredient ID: NPC212770

Ingredient ID: NPC205796

Ingredient ID: NPC205054

Ingredient ID: NPC203719

Ingredient ID: NPC202472

Ingredient ID: NPC199194

Ingredient ID: NPC194416

Ingredient ID: NPC192612

Ingredient ID: NPC186418

Ingredient ID: NPC176015

Ingredient ID: NPC171721

Ingredient ID: NPC170807

Ingredient ID: NPC160345

Ingredient ID: NPC156654

Ingredient ID: NPC155930

Ingredient ID: NPC150919

Ingredient ID: NPC147583

Ingredient ID: NPC141799

Ingredient ID: NPC140201

Ingredient ID: NPC130833

Ingredient ID: NPC130754

Ingredient ID: NPC111888

Ingredient ID: NPC111625