• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Petroselinum Crispum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGCGATAGCAGAATGACCCGCTAACACGTAAACACATTGGGCAAGCGTCAGAGGGCTTCGGTCCCCTGTTTGCGAACCCTTGGTAGGTGGCCCCTCTGTAGTGGCCATCGGCCTACAAAATCATCCGGGCGCGGAATGCGCCAAGGAACTTTAAATTGAATTGTACATTCGCTTCCCGTTAGCGGGCAGCAATGTCATTCCAAAACACAACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCAATAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCAATTACTTGCCCCCAACCACTCATTCCTTGATTGGATGTGCTGGTATTTGGGCGGAAATTGGCCTCCCGTGCCTTGCTGCGCGGCTGGTGCAAAAGTGAGTCTCCGACGACGGACGTCGTGACATCGGTGGTTGTAAAAGACCCTCTTTTCTTGTCGCACGAATCCATGTCATCTTAGTGAGCTCGAGGACCCTTAGGCGCAACAGACTTTTTCGCCCTAACTGGACCCCAGTCAGGCCGACTACCCAATTT

Click for details-----ITS1

TCGAATCCTGCGATAGCAGAATGACCCGCTAACACGTAAACACATTGGGCAAGCGTCAGAGGGCTTCGGTCCCCTGTTTGCGAACCCTTGGTAGGTGGCCCCTCTGTAGTGGCCATCGGCCTACAAAATCATCCGGGCGCGGAATGCGCCAAGGAACTTTAAATTGAATTGTACATTCGCTTCCCGTTAGCGGGCAGCAATGTCATTCCAAAACACAA

Click for details-----ITS2

AATTACTTGCCCCCAACCACTCATTCCTTGATTGGATGTGCTGGTATTTGGGCGGAAATTGGCCTCCCGTGCCTTGCTGCGCGGCTGGTGCAAAAGTGAGTCTCCGACGACGGACGTCGTGACATCGGTGGTTGTAAAAGACCCTCTTTTCTTGTCGCACGAATCCATGTCATCTTAGTGAGCTCGAGGACCCTTAGGCGCAACAGACTTTTTCGCCCTAACTGGACCCCAGTCAGGCCGACTACCCAATTT
Taxonomic Information

Plant ID: NPO5954
Plant Latin Name: Petroselinum Crispum
Taxonomy Genus: Petroselinum
Taxonomy Family: Apiaceae

Plant External Links:

NCBI TaxonomyDB: 4043
Plant-of-the-World-Online: 60442790-2

Used in Medicines

Country/Region:
Turkey; Israel; Italy; South Africa; India; Finland; Lebanon; Jordan; China; Chile; Thailand; Argentina; Spain

Traditional Medicine System:
TCM; Homeopathy


Medicinal Functions:

Antidandruff; Antispasmodic; Aperient; Birthing aid; Cancer; Carminative; Depurative; Digestive; Diuretic; Emmenagogue; Expectorant; Galactofuge; Kidney; Odontalgic; Ophthalmic; Poultice; Skin; Stings; Stomachic; Tonic

Geographical Distribution

Turkey; Italy; Peru; Lebanon; France; Ireland; Argentina; Norway; Israel; Belarus; Algeria; Jordan; Cape Verde; Russia; Trinidad and Tobago; China; Chile; Belgium; Germany; Haiti; Spain; Ukraine; Libya; Denmark; Poland; Finland; Mauritius; Morocco; Sweden; Thailand; Switzerland; Dominican Republic; Bulgaria; Romania; Albania; Portugal; Mexico; Egypt; South Africa; India; United Kingdom; Tunisia; Austria; Greece; Hungary

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

167 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


121 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

112 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99734

Ingredient ID: NPC99428

Ingredient ID: NPC97805

Ingredient ID: NPC96286

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC92869

Ingredient ID: NPC92114

Ingredient ID: NPC91226

Ingredient ID: NPC88566

Ingredient ID: NPC88445

Ingredient ID: NPC85813

Ingredient ID: NPC85488

Ingredient ID: NPC84654

Ingredient ID: NPC83421

Ingredient ID: NPC81010

Ingredient ID: NPC78551

Ingredient ID: NPC76817

Ingredient ID: NPC74539

Ingredient ID: NPC72335

Ingredient ID: NPC71853

Ingredient ID: NPC67450

Ingredient ID: NPC62045

Ingredient ID: NPC61769

Ingredient ID: NPC60151

Ingredient ID: NPC59650

Ingredient ID: NPC59581

Ingredient ID: NPC58957

Ingredient ID: NPC55412

Ingredient ID: NPC55063

Ingredient ID: NPC5413

Ingredient ID: NPC52005

Ingredient ID: NPC51146

Ingredient ID: NPC50898

Ingredient ID: NPC491218

Ingredient ID: NPC490454

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC489986

Ingredient ID: NPC489907

Ingredient ID: NPC489899

Ingredient ID: NPC48623

Ingredient ID: NPC469006

Ingredient ID: NPC424

Ingredient ID: NPC39426

Ingredient ID: NPC3649

Ingredient ID: NPC36061

Ingredient ID: NPC34764

Ingredient ID: NPC33320

Ingredient ID: NPC328447

Ingredient ID: NPC320126

Ingredient ID: NPC317120

Ingredient ID: NPC313955

Ingredient ID: NPC312800

Ingredient ID: NPC308217

Ingredient ID: NPC306611

Ingredient ID: NPC302191

Ingredient ID: NPC29883

Ingredient ID: NPC296985

Ingredient ID: NPC296337

Ingredient ID: NPC295644

Ingredient ID: NPC294548

Ingredient ID: NPC293023

Ingredient ID: NPC290319

Ingredient ID: NPC289918

Ingredient ID: NPC289366

Ingredient ID: NPC286774

Ingredient ID: NPC281686

Ingredient ID: NPC279865

Ingredient ID: NPC279121

Ingredient ID: NPC278220

Ingredient ID: NPC278010

Ingredient ID: NPC276384

Ingredient ID: NPC275462

Ingredient ID: NPC272614

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC26906

Ingredient ID: NPC2660

Ingredient ID: NPC264784

Ingredient ID: NPC264268

Ingredient ID: NPC261831

Ingredient ID: NPC255042

Ingredient ID: NPC254713

Ingredient ID: NPC246165

Ingredient ID: NPC244301

Ingredient ID: NPC243509

Ingredient ID: NPC242580

Ingredient ID: NPC237812

Ingredient ID: NPC234536

Ingredient ID: NPC233571

Ingredient ID: NPC232247

Ingredient ID: NPC229262

Ingredient ID: NPC22832

Ingredient ID: NPC226453

Ingredient ID: NPC226027

Ingredient ID: NPC225710

Ingredient ID: NPC219143

Ingredient ID: NPC215632

Ingredient ID: NPC213876

Ingredient ID: NPC213749

Ingredient ID: NPC210003

Ingredient ID: NPC208793

Ingredient ID: NPC20791

Ingredient ID: NPC207851

Ingredient ID: NPC204120

Ingredient ID: NPC203468

Ingredient ID: NPC202189

Ingredient ID: NPC199072

Ingredient ID: NPC197356

Ingredient ID: NPC191347

Ingredient ID: NPC190771

Ingredient ID: NPC189853

Ingredient ID: NPC189436

Ingredient ID: NPC187770

Ingredient ID: NPC187407

Ingredient ID: NPC185755

Ingredient ID: NPC183454

Ingredient ID: NPC182794

Ingredient ID: NPC180871

Ingredient ID: NPC17810

Ingredient ID: NPC177112

Ingredient ID: NPC176740

Ingredient ID: NPC175987

Ingredient ID: NPC174246

Ingredient ID: NPC173280

Ingredient ID: NPC171648

Ingredient ID: NPC169749

Ingredient ID: NPC168855

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC166362

Ingredient ID: NPC164487

Ingredient ID: NPC163755

Ingredient ID: NPC163297

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC149803

Ingredient ID: NPC149540

Ingredient ID: NPC147983

Ingredient ID: NPC146522

Ingredient ID: NPC144023

Ingredient ID: NPC140864

Ingredient ID: NPC138113

Ingredient ID: NPC137958

Ingredient ID: NPC136014

Ingredient ID: NPC134730

Ingredient ID: NPC133671

Ingredient ID: NPC133225

Ingredient ID: NPC131070

Ingredient ID: NPC130683

Ingredient ID: NPC126681

Ingredient ID: NPC125062

Ingredient ID: NPC124385

Ingredient ID: NPC122809

Ingredient ID: NPC120926

Ingredient ID: NPC119949

Ingredient ID: NPC11812

Ingredient ID: NPC116775

Ingredient ID: NPC116003

Ingredient ID: NPC11433

Ingredient ID: NPC112890

Ingredient ID: NPC111888

Ingredient ID: NPC108954

Ingredient ID: NPC108218

Ingredient ID: NPC105691

Ingredient ID: NPC105246