• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Anchusa Officinalis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGCATAGCAGAACCACTCGCGAACAAGTTAACAACAAACATGGCATGGTGGAGCGTGGGGGATACCTCACATTCTAGTGTGCCTGATGGTGCCCAGGCATTTTGCCTCGGTGCTCAACAAAACCCCGGCGTGAGAAACGCCAAGGAGTACTATAACAAGTGTCTTAACCGTCCTCTCCCGATAAAGGGGCCAAGGGGATTGGGATGGATTCTTTCTAAACCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCTTGAAGCCATTAGGCTAAAGGCACGTCTGCCTGGGCGTCACGCATCACGGTACTCCATCCACACGATTTCGACGGATGGGGTTGAATCTGACCTCGTGTGACTGAAGAGTTGCAGTTGGTCGAAATTTAGATGCGGAGCTTAGGACTTCACGACAAGTGGTGGTTGTTTAACAACTAGCGTCATGTCGTGTGCCAAAGCTACTCGACTCTCAAGATCCTAAGGCGCATGTTATCCTTCTTACTTTGGTTGGAAAACTTGTGCTACGA

Click for details-----ITS1

NA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO5911
Plant Latin Name: Anchusa Officinalis
Taxonomy Genus: Anchusa
Taxonomy Family: Boraginaceae

Plant External Links:

NCBI TaxonomyDB: 89630
Plant-of-the-World-Online: 113312-1

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM


Medicinal Functions:

Demulcent; Expectorant; Homeopathy

Geographical Distribution

Turkey; Italy; France; Argentina; Norway; Belarus; China; Belgium; Germany; Kazakhstan; Spain; Ukraine; Netherlands; Denmark; Poland; Finland; United States; Sweden; Switzerland; Russia; Bulgaria; Romania; Albania; Austria; Greece; Hungary

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

58 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


54 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

19 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99886

Ingredient ID: NPC89798

Ingredient ID: NPC83028

Ingredient ID: NPC79913

Ingredient ID: NPC71853

Ingredient ID: NPC71327

Ingredient ID: NPC65517

Ingredient ID: NPC61779

Ingredient ID: NPC57879

Ingredient ID: NPC51114

Ingredient ID: NPC47844

Ingredient ID: NPC4718

Ingredient ID: NPC44489

Ingredient ID: NPC38209

Ingredient ID: NPC315

Ingredient ID: NPC31279

Ingredient ID: NPC306988

Ingredient ID: NPC306647

Ingredient ID: NPC305205

Ingredient ID: NPC303740

Ingredient ID: NPC303621

Ingredient ID: NPC300017

Ingredient ID: NPC297450

Ingredient ID: NPC289475

Ingredient ID: NPC281387

Ingredient ID: NPC276222

Ingredient ID: NPC271527

Ingredient ID: NPC269919

Ingredient ID: NPC268862

Ingredient ID: NPC264288

Ingredient ID: NPC263222

Ingredient ID: NPC258171

Ingredient ID: NPC257190

Ingredient ID: NPC251306

Ingredient ID: NPC240718

Ingredient ID: NPC232881

Ingredient ID: NPC232375

Ingredient ID: NPC21144

Ingredient ID: NPC209705

Ingredient ID: NPC193812

Ingredient ID: NPC188501

Ingredient ID: NPC176326

Ingredient ID: NPC16737

Ingredient ID: NPC16525

Ingredient ID: NPC164958

Ingredient ID: NPC159312

Ingredient ID: NPC156654

Ingredient ID: NPC144557

Ingredient ID: NPC139576

Ingredient ID: NPC13755

Ingredient ID: NPC130849

Ingredient ID: NPC126825

Ingredient ID: NPC125793

Ingredient ID: NPC125564

Ingredient ID: NPC119039

Ingredient ID: NPC118636

Ingredient ID: NPC109875

Ingredient ID: NPC108441