• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Catharanthus Roseus


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGTAAAGCAAACCGGCGAACTTGTTCTTAACTCGGGCCTCGAGCAAGGGGTCTCTAGGGACTACCTGCTCGTTGCCCCCTCGGCCTGCCGAGTGCCCTTGGGCAACCGGTCGTGCCTAACAACAAACCCCGGCGCGGAAAGCGCCAAGGACTACTCAAGTGGGATTGCCTTCCCTAGGTCGGCCCGTTCGCGGTGCTGTCCTTGGGAGCTAAGGCACCTTTGTAAACCAAAACGACTCTCGGCAACGGATATCTAGGCTCTCGCATCGATGAAGAACGTAGCAAACTGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCCCGTCGCCCTCCCCTCGCCTCGTCCATCTGTGGATGACTCGGCGCTTGAGGGAGGACGTATATTGGCCTCCCGTGCATTACTCGCGGTTGGCCTAAATCTTGGTCCCTTGCTGCGGACGTCACGACAAGTGGTGGTTGAAATCCTCAACTCGAATGCGAGTCGTGACGAGAACCGCGGTCTAGGTGTCCGAACGACCCCTGTTGCTAGCCCTTCCCCCTCGAAAGAGCACGAGCGCTTGTCACGACTGCGACCCCCGGTCACGTGGGACTACCCCCCTGATTT

Click for details-----ITS1

AAGGATCATTGTCGAATCCTGTAAAACAAACCGGCAAACTTGTTTTTAACTCGGGCCTCGAGCAAGGGGTCTCTAGGGACTACCTGCTCGTTGCCCCCTGGGCCTGCCGAGTGCCCTTGGGCAACCGGTCGTGCCTAACAACAAACCCGGGCGCGGAAAGCGCCAAGGACTACTCAAGTGGGATTGCCTTCCCTAGGTCGGCCCGTTCCCGGTGCTGTCCTTGGGAGCTAAGGCACCTTTGTAAACCAAAA

Click for details-----ITS2

ATCCCGTCGCCCTCCCCTCGCCTCGTCCATCTGTGGATGACTCGGCGCTTGAGGGAGGACGTATATTGGCCTCCCGTGCATTACTCGCGGTTGGCCTAAATCTTGGTCCCTTGCTGCGGACGTCACGACAAGTGGTGGTTGAAATCCTCAACTCGAATGCGAGTCGTGACGAGAACCGCGGTCTAGGTGTCCGAACGACCCCTGTTGCTAGCCCTTCCCCCTCGAAAGAGCACGAGCGCTTGTCACGACTGCGACCCCCGGTCACGTGGGACTACCCCCCTGATTT
Taxonomic Information

Plant ID: NPO5881
Plant Latin Name: Catharanthus Roseus
Taxonomy Genus: Catharanthus
Taxonomy Family: Apocynaceae

Plant External Links:

NCBI TaxonomyDB: 4058
Plant-of-the-World-Online: 77880-1

Used in Medicines

Country/Region:
Brazil; Pakistan; Madagascar; Australia; Rwanda; Indonesia; Mexico; Philippines; South Africa; India; France; United States; Vietnam; Jordan; China; Kenya; Thailand; Nigeria; Tanzania

Traditional Medicine System:
Indian Folk; TCM; Ayurveda; Siddha

Geographical Distribution

Brazil; Madagascar; Italy; Bangladesh; Kenya; Costa Rica; Cambodia; France; Bahamas; Ethiopia; Netherlands; Tanzania; Nigeria; Cameroon; Cote d'Ivoire; Ecuador; Benin; Australia; Cuba; El Salvador; Thailand; Senegal; Burkina Faso; Togo; Guatemala; China; Jordan; Dominican Republic; Belize; United States; Sierra Leone; Eritrea; Maldives; Pakistan; Gambia; Philippines; Indonesia; New Caledonia; Mauritius; Trinidad and Tobago; Vietnam; French Guiana; Japan; Haiti; Jamaica; Seychelles; Honduras; Myanmar; Chad; Mexico; Nicaragua; South Africa; India; Djibouti; Rwanda; Mozambique; Uganda; Gabon; Taiwan; Fiji

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

187 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


120 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

62 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99921

Ingredient ID: NPC9971

Ingredient ID: NPC97787

Ingredient ID: NPC94721

Ingredient ID: NPC94234

Ingredient ID: NPC90723

Ingredient ID: NPC88566

Ingredient ID: NPC88445

Ingredient ID: NPC88278

Ingredient ID: NPC87780

Ingredient ID: NPC86782

Ingredient ID: NPC83535

Ingredient ID: NPC79732

Ingredient ID: NPC79056

Ingredient ID: NPC78498

Ingredient ID: NPC78404

Ingredient ID: NPC7818

Ingredient ID: NPC76145

Ingredient ID: NPC7568

Ingredient ID: NPC7453

Ingredient ID: NPC71886

Ingredient ID: NPC66569

Ingredient ID: NPC63591

Ingredient ID: NPC62806

Ingredient ID: NPC62086

Ingredient ID: NPC61312

Ingredient ID: NPC53042

Ingredient ID: NPC4899

Ingredient ID: NPC481036

Ingredient ID: NPC481035

Ingredient ID: NPC48028

Ingredient ID: NPC476192

Ingredient ID: NPC476148

Ingredient ID: NPC476147

Ingredient ID: NPC475620

Ingredient ID: NPC475430

Ingredient ID: NPC40857

Ingredient ID: NPC39034

Ingredient ID: NPC37009

Ingredient ID: NPC3649

Ingredient ID: NPC329454

Ingredient ID: NPC329050

Ingredient ID: NPC328670

Ingredient ID: NPC328521

Ingredient ID: NPC327325

Ingredient ID: NPC325325

Ingredient ID: NPC324489

Ingredient ID: NPC324460

Ingredient ID: NPC323346

Ingredient ID: NPC322856

Ingredient ID: NPC322832

Ingredient ID: NPC322476

Ingredient ID: NPC322271

Ingredient ID: NPC321979

Ingredient ID: NPC321858

Ingredient ID: NPC3191

Ingredient ID: NPC317801

Ingredient ID: NPC317061

Ingredient ID: NPC316127

Ingredient ID: NPC315634

Ingredient ID: NPC315484

Ingredient ID: NPC314333

Ingredient ID: NPC312996

Ingredient ID: NPC30749

Ingredient ID: NPC300098

Ingredient ID: NPC299529

Ingredient ID: NPC29896

Ingredient ID: NPC295281

Ingredient ID: NPC294909

Ingredient ID: NPC294887

Ingredient ID: NPC294179

Ingredient ID: NPC290495

Ingredient ID: NPC289316

Ingredient ID: NPC289299

Ingredient ID: NPC287660

Ingredient ID: NPC284967

Ingredient ID: NPC283746

Ingredient ID: NPC281879

Ingredient ID: NPC2803

Ingredient ID: NPC276993

Ingredient ID: NPC276931

Ingredient ID: NPC273756

Ingredient ID: NPC272753

Ingredient ID: NPC27184

Ingredient ID: NPC271270

Ingredient ID: NPC270946

Ingredient ID: NPC270783

Ingredient ID: NPC270695

Ingredient ID: NPC270334

Ingredient ID: NPC2665

Ingredient ID: NPC26639

Ingredient ID: NPC26383

Ingredient ID: NPC262789

Ingredient ID: NPC262505

Ingredient ID: NPC260909

Ingredient ID: NPC255042

Ingredient ID: NPC254975

Ingredient ID: NPC253786

Ingredient ID: NPC25232

Ingredient ID: NPC2499

Ingredient ID: NPC248799

Ingredient ID: NPC248139

Ingredient ID: NPC239039

Ingredient ID: NPC238457

Ingredient ID: NPC238376

Ingredient ID: NPC237901

Ingredient ID: NPC237208

Ingredient ID: NPC234086

Ingredient ID: NPC233628

Ingredient ID: NPC233024

Ingredient ID: NPC232954

Ingredient ID: NPC232375

Ingredient ID: NPC230305

Ingredient ID: NPC227854

Ingredient ID: NPC221652

Ingredient ID: NPC22098

Ingredient ID: NPC216381

Ingredient ID: NPC215894

Ingredient ID: NPC214909

Ingredient ID: NPC213749

Ingredient ID: NPC210955

Ingredient ID: NPC206161

Ingredient ID: NPC199616

Ingredient ID: NPC197580

Ingredient ID: NPC197312

Ingredient ID: NPC195788

Ingredient ID: NPC194497

Ingredient ID: NPC193410

Ingredient ID: NPC192740

Ingredient ID: NPC190771

Ingredient ID: NPC188238

Ingredient ID: NPC188017

Ingredient ID: NPC187609

Ingredient ID: NPC185844

Ingredient ID: NPC185414

Ingredient ID: NPC18351

Ingredient ID: NPC182840

Ingredient ID: NPC18205

Ingredient ID: NPC180059

Ingredient ID: NPC176862

Ingredient ID: NPC175474

Ingredient ID: NPC174908

Ingredient ID: NPC174788

Ingredient ID: NPC174749

Ingredient ID: NPC173381

Ingredient ID: NPC170271

Ingredient ID: NPC170067

Ingredient ID: NPC169468

Ingredient ID: NPC166474

Ingredient ID: NPC163248

Ingredient ID: NPC162656

Ingredient ID: NPC160842

Ingredient ID: NPC159963

Ingredient ID: NPC157671

Ingredient ID: NPC156461

Ingredient ID: NPC154302

Ingredient ID: NPC154176

Ingredient ID: NPC153731

Ingredient ID: NPC15049

Ingredient ID: NPC148337

Ingredient ID: NPC147712

Ingredient ID: NPC147216

Ingredient ID: NPC143533

Ingredient ID: NPC142656

Ingredient ID: NPC139546

Ingredient ID: NPC138113

Ingredient ID: NPC137589

Ingredient ID: NPC13739

Ingredient ID: NPC134616

Ingredient ID: NPC133178

Ingredient ID: NPC131774

Ingredient ID: NPC130854

Ingredient ID: NPC13007

Ingredient ID: NPC129871

Ingredient ID: NPC127996

Ingredient ID: NPC120926

Ingredient ID: NPC120391

Ingredient ID: NPC118844

Ingredient ID: NPC114239

Ingredient ID: NPC11391

Ingredient ID: NPC11177

Ingredient ID: NPC111265

Ingredient ID: NPC108849

Ingredient ID: NPC104381

Ingredient ID: NPC103875

Ingredient ID: NPC103775

Ingredient ID: NPC100879