• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Salvia Miltiorrhiza


Example Image
PLANiTS DNA barcode

Click for details-----ITS

ATTCCGTAAAGGGGGGAGCCTGCGGAAGGATCATTGTCGAAACCTGCAAAGCAGACCGCGAACACGTGTTTAACACTGCCGGGTGCGCGGCGTGGGGGCAACCCCCGTCTCGTACTCGGTTCCCTGCCGGCGCGCGTCCTCGGGCCGTGTCGTGCGGGCTAACGAACCCCGGCGCGGAATGCGCCAAGGAATACTAATCGAAGCGTCCGCCCCCTGTGCTCCGTTCGCGGTGTGTGCGGGGGGACCGGATGTCTATCAAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCCTCCCCGCGTAAAGCGTGGGTTGTGGGGGCGGAAACTGGCCTCCCGTGTGCCTCGGTGCGCGGCTGGCCCAAATGTGATCCCTCGGCGACTCATGTCGCGACAAGTGGTGGTTGAACAACTCACTCTCGTGTCGTGCTTCTGTGTCGCTAGTATGGGCATCCATCAATGACCCAATGGTGTCGGCGCCACACGGTGCCCCACCTTCGACCGCGACCCCAGTCAGGCGGATG

Click for details-----ITS1

ACCCCTTCGTTTAAGGGGACCTGCGGAAGGATCATTGTCGAAACCTGCAAAGCAGACCGCGAACACGTGTTTAACACTGCCGGGTGCGCGGCGTGGGGGCAACCCCCGTCTCGTACTCGGTTCCCTGCCGGCGCGCGTCCTCGGGCCGTGTCGTGCGGGCTAACGAACCCCGGCGCGGAATGCGCCAAGGAATACTAATCGAAGCGTCCGCCCCCTGTGCTCCGTTCGCGGTGTGTGCGGGGGGACCGGATGTCTATCAAATGTCAAAA

Click for details-----ITS2

ATCGCGTCGCCCCCCTCCCCGCGTAAAGCGTGGGTTGTGGGGGCGGAAACTGGCCTCCCGTGTGCCTCGGTGCGCGGCTGGCCCAAATGTGATCCCTCGGCGACTCATGTCGCGACAAGTGGTGGTTGAACAACTCACTCTCGTGTCGTGCTTCTGTGTCGCTAGTATGGGCATCCATCAATGACCCAATGGTGTCGGCGCCACACGGTGCCCCACCTTCGACCGCGACCCCAGTCATCGGATCCGT
Taxonomic Information

Plant ID: NPO5743
Plant Latin Name: Salvia Miltiorrhiza
Taxonomy Genus: Salvia
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 226208
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
South Korea; China

Traditional Medicine System:
TCM

Geographical Distribution

South Korea; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

348 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


240 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

151 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99700

Ingredient ID: NPC99244

Ingredient ID: NPC988

Ingredient ID: NPC97678

Ingredient ID: NPC96403

Ingredient ID: NPC94874

Ingredient ID: NPC94789

Ingredient ID: NPC94437

Ingredient ID: NPC93241

Ingredient ID: NPC92320

Ingredient ID: NPC92246

Ingredient ID: NPC90172

Ingredient ID: NPC89146

Ingredient ID: NPC88958

Ingredient ID: NPC87832

Ingredient ID: NPC87640

Ingredient ID: NPC87545

Ingredient ID: NPC87517

Ingredient ID: NPC87516

Ingredient ID: NPC87028

Ingredient ID: NPC85813

Ingredient ID: NPC85771

Ingredient ID: NPC85724

Ingredient ID: NPC84738

Ingredient ID: NPC81455

Ingredient ID: NPC80894

Ingredient ID: NPC78965

Ingredient ID: NPC78655

Ingredient ID: NPC78408

Ingredient ID: NPC78372

Ingredient ID: NPC78341

Ingredient ID: NPC78024

Ingredient ID: NPC7753

Ingredient ID: NPC77000

Ingredient ID: NPC76419

Ingredient ID: NPC75724

Ingredient ID: NPC75555

Ingredient ID: NPC72722

Ingredient ID: NPC72695

Ingredient ID: NPC72667

Ingredient ID: NPC71637

Ingredient ID: NPC71132

Ingredient ID: NPC70744

Ingredient ID: NPC70741

Ingredient ID: NPC70555

Ingredient ID: NPC69445

Ingredient ID: NPC6930

Ingredient ID: NPC68562

Ingredient ID: NPC6501

Ingredient ID: NPC63126

Ingredient ID: NPC62290

Ingredient ID: NPC61477

Ingredient ID: NPC61

Ingredient ID: NPC60152

Ingredient ID: NPC5968

Ingredient ID: NPC57970

Ingredient ID: NPC56400

Ingredient ID: NPC55923

Ingredient ID: NPC54377

Ingredient ID: NPC53545

Ingredient ID: NPC52088

Ingredient ID: NPC51843

Ingredient ID: NPC51700

Ingredient ID: NPC51429

Ingredient ID: NPC50988

Ingredient ID: NPC49994

Ingredient ID: NPC486823

Ingredient ID: NPC486822

Ingredient ID: NPC486821

Ingredient ID: NPC485352

Ingredient ID: NPC485351

Ingredient ID: NPC485350

Ingredient ID: NPC485349

Ingredient ID: NPC485348

Ingredient ID: NPC485347

Ingredient ID: NPC485346

Ingredient ID: NPC485345

Ingredient ID: NPC485344

Ingredient ID: NPC485343

Ingredient ID: NPC485342

Ingredient ID: NPC485341

Ingredient ID: NPC478794

Ingredient ID: NPC478793

Ingredient ID: NPC47725

Ingredient ID: NPC47489

Ingredient ID: NPC461214

Ingredient ID: NPC44272

Ingredient ID: NPC418074

Ingredient ID: NPC417745

Ingredient ID: NPC41494

Ingredient ID: NPC39426

Ingredient ID: NPC38473

Ingredient ID: NPC38065

Ingredient ID: NPC38042

Ingredient ID: NPC37859

Ingredient ID: NPC37333

Ingredient ID: NPC36184

Ingredient ID: NPC34052

Ingredient ID: NPC33574

Ingredient ID: NPC329220

Ingredient ID: NPC329148

Ingredient ID: NPC328267

Ingredient ID: NPC328107

Ingredient ID: NPC327897

Ingredient ID: NPC327537

Ingredient ID: NPC327194

Ingredient ID: NPC327134

Ingredient ID: NPC327117

Ingredient ID: NPC326274

Ingredient ID: NPC326092

Ingredient ID: NPC326050

Ingredient ID: NPC325794

Ingredient ID: NPC325653

Ingredient ID: NPC325128

Ingredient ID: NPC324647

Ingredient ID: NPC323787

Ingredient ID: NPC323440

Ingredient ID: NPC323434

Ingredient ID: NPC322523

Ingredient ID: NPC321321

Ingredient ID: NPC320846

Ingredient ID: NPC320799

Ingredient ID: NPC320590

Ingredient ID: NPC318785

Ingredient ID: NPC318173

Ingredient ID: NPC318067

Ingredient ID: NPC317696

Ingredient ID: NPC317136

Ingredient ID: NPC316829

Ingredient ID: NPC316790

Ingredient ID: NPC313163

Ingredient ID: NPC311866

Ingredient ID: NPC310942

Ingredient ID: NPC30997

Ingredient ID: NPC309606

Ingredient ID: NPC309318

Ingredient ID: NPC309056

Ingredient ID: NPC309036

Ingredient ID: NPC308379

Ingredient ID: NPC307672

Ingredient ID: NPC3071

Ingredient ID: NPC307063

Ingredient ID: NPC30480

Ingredient ID: NPC303494

Ingredient ID: NPC302981

Ingredient ID: NPC302857

Ingredient ID: NPC302711

Ingredient ID: NPC301691

Ingredient ID: NPC301089

Ingredient ID: NPC299094

Ingredient ID: NPC298716

Ingredient ID: NPC297575

Ingredient ID: NPC297409

Ingredient ID: NPC296929

Ingredient ID: NPC295701

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC294154

Ingredient ID: NPC290613

Ingredient ID: NPC290598

Ingredient ID: NPC290249

Ingredient ID: NPC29

Ingredient ID: NPC289774

Ingredient ID: NPC289432

Ingredient ID: NPC288537

Ingredient ID: NPC285893

Ingredient ID: NPC284237

Ingredient ID: NPC283173

Ingredient ID: NPC282542

Ingredient ID: NPC281398

Ingredient ID: NPC279121

Ingredient ID: NPC278652

Ingredient ID: NPC278102

Ingredient ID: NPC27798

Ingredient ID: NPC277467

Ingredient ID: NPC276305

Ingredient ID: NPC270476

Ingredient ID: NPC267021

Ingredient ID: NPC265784

Ingredient ID: NPC265376

Ingredient ID: NPC264711

Ingredient ID: NPC264317

Ingredient ID: NPC264196

Ingredient ID: NPC263995

Ingredient ID: NPC262573

Ingredient ID: NPC262202

Ingredient ID: NPC261831

Ingredient ID: NPC260233

Ingredient ID: NPC260060

Ingredient ID: NPC259745

Ingredient ID: NPC259684

Ingredient ID: NPC257862

Ingredient ID: NPC257296

Ingredient ID: NPC25581

Ingredient ID: NPC255617

Ingredient ID: NPC255463

Ingredient ID: NPC253481

Ingredient ID: NPC2529

Ingredient ID: NPC252747

Ingredient ID: NPC249435

Ingredient ID: NPC249045

Ingredient ID: NPC249018

Ingredient ID: NPC247832

Ingredient ID: NPC245919

Ingredient ID: NPC243728

Ingredient ID: NPC242580

Ingredient ID: NPC24232

Ingredient ID: NPC241776

Ingredient ID: NPC239185

Ingredient ID: NPC238861

Ingredient ID: NPC238041

Ingredient ID: NPC237435

Ingredient ID: NPC237395

Ingredient ID: NPC236722

Ingredient ID: NPC236709

Ingredient ID: NPC236657

Ingredient ID: NPC235625

Ingredient ID: NPC23559

Ingredient ID: NPC233023

Ingredient ID: NPC232958

Ingredient ID: NPC230683

Ingredient ID: NPC230301

Ingredient ID: NPC229734

Ingredient ID: NPC226505

Ingredient ID: NPC226429

Ingredient ID: NPC223629

Ingredient ID: NPC222968

Ingredient ID: NPC221992

Ingredient ID: NPC22140

Ingredient ID: NPC220089

Ingredient ID: NPC219876

Ingredient ID: NPC21949

Ingredient ID: NPC218948

Ingredient ID: NPC218109

Ingredient ID: NPC216403

Ingredient ID: NPC215345

Ingredient ID: NPC212207

Ingredient ID: NPC210216

Ingredient ID: NPC209970

Ingredient ID: NPC209560

Ingredient ID: NPC209241

Ingredient ID: NPC20840

Ingredient ID: NPC20791

Ingredient ID: NPC205930

Ingredient ID: NPC205823

Ingredient ID: NPC203313

Ingredient ID: NPC202656

Ingredient ID: NPC202244

Ingredient ID: NPC196512

Ingredient ID: NPC195019

Ingredient ID: NPC194857

Ingredient ID: NPC192638

Ingredient ID: NPC19116

Ingredient ID: NPC190313

Ingredient ID: NPC189632

Ingredient ID: NPC189197

Ingredient ID: NPC188523

Ingredient ID: NPC187517

Ingredient ID: NPC18695

Ingredient ID: NPC186795

Ingredient ID: NPC186392

Ingredient ID: NPC186100

Ingredient ID: NPC185750

Ingredient ID: NPC185197

Ingredient ID: NPC184728

Ingredient ID: NPC184683

Ingredient ID: NPC184460

Ingredient ID: NPC183950

Ingredient ID: NPC183626

Ingredient ID: NPC181786

Ingredient ID: NPC181723

Ingredient ID: NPC180798

Ingredient ID: NPC18074

Ingredient ID: NPC179950

Ingredient ID: NPC179297

Ingredient ID: NPC179170

Ingredient ID: NPC1788

Ingredient ID: NPC176521

Ingredient ID: NPC176130

Ingredient ID: NPC175662

Ingredient ID: NPC174611

Ingredient ID: NPC171082

Ingredient ID: NPC168951

Ingredient ID: NPC168799

Ingredient ID: NPC167976

Ingredient ID: NPC167932

Ingredient ID: NPC166641

Ingredient ID: NPC164706

Ingredient ID: NPC164487

Ingredient ID: NPC163649

Ingredient ID: NPC163466

Ingredient ID: NPC161206

Ingredient ID: NPC158295

Ingredient ID: NPC156654

Ingredient ID: NPC15658

Ingredient ID: NPC153088

Ingredient ID: NPC152107

Ingredient ID: NPC150324

Ingredient ID: NPC149543

Ingredient ID: NPC149184

Ingredient ID: NPC146716

Ingredient ID: NPC145830

Ingredient ID: NPC145379

Ingredient ID: NPC144557

Ingredient ID: NPC144547

Ingredient ID: NPC144010

Ingredient ID: NPC142753

Ingredient ID: NPC142415

Ingredient ID: NPC140182

Ingredient ID: NPC139364

Ingredient ID: NPC13879

Ingredient ID: NPC137542

Ingredient ID: NPC134882

Ingredient ID: NPC133671

Ingredient ID: NPC132585

Ingredient ID: NPC131853

Ingredient ID: NPC130683

Ingredient ID: NPC130577

Ingredient ID: NPC130057

Ingredient ID: NPC127584

Ingredient ID: NPC126759

Ingredient ID: NPC125637

Ingredient ID: NPC124963

Ingredient ID: NPC123663

Ingredient ID: NPC123112

Ingredient ID: NPC120737

Ingredient ID: NPC120116

Ingredient ID: NPC117674

Ingredient ID: NPC117418

Ingredient ID: NPC117193

Ingredient ID: NPC116775

Ingredient ID: NPC115435

Ingredient ID: NPC115321

Ingredient ID: NPC114103

Ingredient ID: NPC111888

Ingredient ID: NPC111249

Ingredient ID: NPC110758

Ingredient ID: NPC109594

Ingredient ID: NPC109514

Ingredient ID: NPC108857

Ingredient ID: NPC108266

Ingredient ID: NPC107949

Ingredient ID: NPC1075

Ingredient ID: NPC103688

Ingredient ID: NPC102158

Ingredient ID: NPC102114

Ingredient ID: NPC101471

Ingredient ID: NPC10051