• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Rumex Nepalensis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TTGTCGAAACCTGCCCAGAGCAGACAGACCCGCGAACCCGTTCCTAACACAAACGGCGCCCCCGGGCGCCGCCAACCCACCCCCGGCGCGGATTGCGCCAAGGACCACGAACAAAATCGCCCCCCGAGCGGCCCGGTCCTCCGGAGCCCGCGCGGCGGCGGCGTGTCGTTTCTACTTAACAAAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTTCTGGCCGAGGGCACGTCTGTCTGGGCGTCACGCACCGCGTCGCCCCCCTCCCCCCTCCGGGGGGACTGGGGGCGGAGACTGGCCCCCCGTGCGCCCCGGCGCGCGGCCGGCCTAAACGCAGACCCCGCGGCCGCGAGAACGGCGCGACGACCGGTGGCGTACTTCATGGCATCGCGTCGCGCCCCCTGCGGCCCCCTGGGAGATCATCGGCCGACACAGCGGACCCCGGTCCACCG

Click for details-----ITS1

GGAGGATTGTCGAAACCTGCCCAGAGCAGACAGACCCGCGAACCCGTTCCTAACACAAACGGCGCCCCCGGGCGCCAACCCACCCCCGGCGCGGATTGCGCCAAGGACCACGAACAAAATCGCCCCCCGAGCGGCCCGGTCCTCCGGAGCCCGCACGGCGGCGGCGTGTCGTTTCTACTTAACAAAAAA

Click for details-----ITS2

ACCGCGTCGCCCCCCTCCCCCCTCCGGGGGGACTGGGGGCGGAGACTGGCCCCCCGTGCGCCCCGGCGCGCGGCCGGCCTAAACGCAGACCCCGCGGCCGCGAGAACGGCGCGACGACCGGTGGCGTACTTCATGGCATCGCGTCGCGCCCCCTGCGGCCCCCTGGGAGATCATCGGCCGACACAGCGGACCCCGGTCCACCG
Taxonomic Information

Plant ID: NPO574
Plant Latin Name: Rumex Nepalensis
Taxonomy Genus: Rumex
Taxonomy Family: Polygonaceae

Plant External Links:

NCBI TaxonomyDB: 174652
Plant-of-the-World-Online: 697338-1

Used in Medicines

Country/Region:
China; Indonesia; India

Traditional Medicine System:
Indian Folk; TCM


Medicinal Functions:

Purgative; Stomachic

Geographical Distribution

Turkey; Madagascar; Italy; Sudan; Ethiopia; Rwanda; Cameroon; Malawi; Zimbabwe; China; Eritrea; Tanzania; Indonesia; Albania; Angola; South Africa; India; Lesotho; Uganda; Greece; Burundi; Kenya

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

56 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


22 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

25 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98405

Ingredient ID: NPC97705

Ingredient ID: NPC93338

Ingredient ID: NPC82980

Ingredient ID: NPC80471

Ingredient ID: NPC76655

Ingredient ID: NPC68440

Ingredient ID: NPC68324

Ingredient ID: NPC677

Ingredient ID: NPC61477

Ingredient ID: NPC60299

Ingredient ID: NPC57801

Ingredient ID: NPC51700

Ingredient ID: NPC50898

Ingredient ID: NPC49291

Ingredient ID: NPC45295

Ingredient ID: NPC328055

Ingredient ID: NPC3224

Ingredient ID: NPC312929

Ingredient ID: NPC312334

Ingredient ID: NPC309140

Ingredient ID: NPC300478

Ingredient ID: NPC29965

Ingredient ID: NPC29883

Ingredient ID: NPC295232

Ingredient ID: NPC282923

Ingredient ID: NPC279459

Ingredient ID: NPC279121

Ingredient ID: NPC274963

Ingredient ID: NPC267205

Ingredient ID: NPC261619

Ingredient ID: NPC254848

Ingredient ID: NPC254847

Ingredient ID: NPC254356

Ingredient ID: NPC243728

Ingredient ID: NPC227689

Ingredient ID: NPC221144

Ingredient ID: NPC218798

Ingredient ID: NPC211084

Ingredient ID: NPC209713

Ingredient ID: NPC20791

Ingredient ID: NPC192638

Ingredient ID: NPC190771

Ingredient ID: NPC189142

Ingredient ID: NPC178383

Ingredient ID: NPC168606

Ingredient ID: NPC165367

Ingredient ID: NPC160499

Ingredient ID: NPC158088

Ingredient ID: NPC132933

Ingredient ID: NPC119966

Ingredient ID: NPC114702

Ingredient ID: NPC114179

Ingredient ID: NPC10859

Ingredient ID: NPC105591

Ingredient ID: NPC100048