• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Acorus Gramineus


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAGGCCCACGGACGAACCACCCCAAGAGAACCCGTCATCAACGTGGCCGGGGAGCAGGCCCGGGGCGGAGCGACGCGTGCGCGTGGCGCCCGCTCCCCTGTTCACCCGGTGCGGCCCCACCCCGCGCGCGGGGAGGGGAAAACGAACAACAACCCCGGCGCGGTCTGCGCCAAGGAACTCTCCTGACAGGAACGAAAGCGGGCGCGGCGCGCGGCAGCGGCCTCTCACCCACCCCGCGGGGATGCCGGCGACGGCAACTCCCGGGGCTGGGAGGGCGGGTGCCAAGCCGCGCGGCGCGCATCGATTCGTAATGGAAACGATGACTCTCGGCAACGGATATCTAGGCTCCCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGACCCCCATCGGGTCGAGGGCACGCCTGCCTGGGCGTCACGCCTTCCGTCGTTCCGCGGCATGATCCCCGCCCGGTGGCGGGGATCGTCCCGGATGCGGATGTTGGCCCTCCGTTCCCCGTGGGCGGTCGGCTGAAACCCAAGGTCCGCCGCGGGTCGCGGCACGGCATGCGGTGGGCTGAGAGGCAGAGCCCCTGCCTCTCGCGTCGGATGTCTTGCCCGGCCGCGCGTCACGGCGGGCCCCTGT

Click for details-----ITS1

TCGAGGCCCACGGACGAACCACCCCAAGAGAACCCGTCATCAACGTGGCCGGGGAGCAGGCCCGGGGCGGAGCGACGCGTGCGCGTGGCGCCCGCTCCCCTGTTCACCCGGTGCGGCCCCACCCCGCGCGCGGGGAGGGGAAAACGAACAACAACCCCGGCGCGGTCTGCGCCAAGGAACTCTCCTGACAGGAACGAAAGCGGGCGCGGCGCGCGGCAGCGGCCTCTCACCCACCCCGCGGGGATGCCGGCGACGGCAACTCCCGGGGCTGGGAGGGCGGGTGCCAAGCCGCGCGGCGCGCATCGATTCGTAATGGAAACGA

Click for details-----ITS2

CTTCCGTCGCTCCGCGGCATCACCCCCCGCCCCATCGGGCGGGGGATCGTCCCGGATGCGGATGCTGGCCCTCCGTTCCCCGTGGGCGGTCGGCTGAAACCCAGGGTCCGCTGCGGGGTCGCGGCACGGCATGCGGTGGGCTGAGAGGCAGAGTCCCTACCTCCGGCGTCGGATGCCTCGCCCGGCCGCGCGTCACAGCGGGCCCTCGAGAACCCCACCATTGCCACCGTGCGCAACGGCAGTCTGGA
Taxonomic Information

Plant ID: NPO5681
Plant Latin Name: Acorus Gramineus
Taxonomy Genus: Acorus
Taxonomy Family: Acoraceae

Plant External Links:

NCBI TaxonomyDB: 55184
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Thailand; South Korea; China; India

Traditional Medicine System:
Indian Folk; TCM


Medicinal Functions:

Anodyne; Antibacterial; Antifungal; Antiperiodic; Antirheumatic; Antispasmodic; Aromatic; Cardiac; Carminative; Diaphoretic; Diuretic; Emmenagogue; Expectorant; Febrifuge; Parasiticide; Sedative; Stimulant; Stomachic; Tonic; Vermifuge

Geographical Distribution

India; South Korea; China; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

240 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


197 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

122 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC96630

Ingredient ID: NPC95675

Ingredient ID: NPC94276

Ingredient ID: NPC93850

Ingredient ID: NPC91627

Ingredient ID: NPC91602

Ingredient ID: NPC91574

Ingredient ID: NPC90803

Ingredient ID: NPC90506

Ingredient ID: NPC89069

Ingredient ID: NPC88566

Ingredient ID: NPC87384

Ingredient ID: NPC85813

Ingredient ID: NPC84793

Ingredient ID: NPC84772

Ingredient ID: NPC84053

Ingredient ID: NPC83294

Ingredient ID: NPC8235

Ingredient ID: NPC7965

Ingredient ID: NPC79576

Ingredient ID: NPC78918

Ingredient ID: NPC78551

Ingredient ID: NPC76817

Ingredient ID: NPC75158

Ingredient ID: NPC7343

Ingredient ID: NPC71853

Ingredient ID: NPC71703

Ingredient ID: NPC71506

Ingredient ID: NPC71306

Ingredient ID: NPC71090

Ingredient ID: NPC68889

Ingredient ID: NPC65933

Ingredient ID: NPC65873

Ingredient ID: NPC65003

Ingredient ID: NPC64176

Ingredient ID: NPC63083

Ingredient ID: NPC57877

Ingredient ID: NPC54264

Ingredient ID: NPC5326

Ingredient ID: NPC52464

Ingredient ID: NPC51189

Ingredient ID: NPC49053

Ingredient ID: NPC4817

Ingredient ID: NPC470624

Ingredient ID: NPC470258

Ingredient ID: NPC45540

Ingredient ID: NPC44751

Ingredient ID: NPC43318

Ingredient ID: NPC43114

Ingredient ID: NPC41473

Ingredient ID: NPC41385

Ingredient ID: NPC41348

Ingredient ID: NPC41004

Ingredient ID: NPC40249

Ingredient ID: NPC36408

Ingredient ID: NPC35961

Ingredient ID: NPC34902

Ingredient ID: NPC3439

Ingredient ID: NPC32222

Ingredient ID: NPC312929

Ingredient ID: NPC31279

Ingredient ID: NPC310905

Ingredient ID: NPC309297

Ingredient ID: NPC308218

Ingredient ID: NPC305327

Ingredient ID: NPC304208

Ingredient ID: NPC301043

Ingredient ID: NPC300649

Ingredient ID: NPC300250

Ingredient ID: NPC30025

Ingredient ID: NPC300017

Ingredient ID: NPC298327

Ingredient ID: NPC297225

Ingredient ID: NPC295998

Ingredient ID: NPC295442

Ingredient ID: NPC294941

Ingredient ID: NPC294136

Ingredient ID: NPC292792

Ingredient ID: NPC292559

Ingredient ID: NPC292092

Ingredient ID: NPC292056

Ingredient ID: NPC291473

Ingredient ID: NPC290319

Ingredient ID: NPC290302

Ingredient ID: NPC290189

Ingredient ID: NPC290078

Ingredient ID: NPC289366

Ingredient ID: NPC288932

Ingredient ID: NPC287731

Ingredient ID: NPC287335

Ingredient ID: NPC287331

Ingredient ID: NPC286626

Ingredient ID: NPC285793

Ingredient ID: NPC285725

Ingredient ID: NPC285371

Ingredient ID: NPC285339

Ingredient ID: NPC285322

Ingredient ID: NPC284731

Ingredient ID: NPC283655

Ingredient ID: NPC282923

Ingredient ID: NPC279969

Ingredient ID: NPC279379

Ingredient ID: NPC27794

Ingredient ID: NPC277736

Ingredient ID: NPC277277

Ingredient ID: NPC274722

Ingredient ID: NPC273607

Ingredient ID: NPC273330

Ingredient ID: NPC273295

Ingredient ID: NPC270326

Ingredient ID: NPC26906

Ingredient ID: NPC268221

Ingredient ID: NPC265885

Ingredient ID: NPC264470

Ingredient ID: NPC263367

Ingredient ID: NPC261080

Ingredient ID: NPC260756

Ingredient ID: NPC254847

Ingredient ID: NPC254156

Ingredient ID: NPC252539

Ingredient ID: NPC251860

Ingredient ID: NPC249815

Ingredient ID: NPC244966

Ingredient ID: NPC24294

Ingredient ID: NPC238097

Ingredient ID: NPC237010

Ingredient ID: NPC231738

Ingredient ID: NPC23145

Ingredient ID: NPC230291

Ingredient ID: NPC229607

Ingredient ID: NPC229403

Ingredient ID: NPC227670

Ingredient ID: NPC225463

Ingredient ID: NPC225245

Ingredient ID: NPC22484

Ingredient ID: NPC223697

Ingredient ID: NPC220860

Ingredient ID: NPC218918

Ingredient ID: NPC218856

Ingredient ID: NPC214909

Ingredient ID: NPC214770

Ingredient ID: NPC214584

Ingredient ID: NPC214115

Ingredient ID: NPC214067

Ingredient ID: NPC21405

Ingredient ID: NPC213749

Ingredient ID: NPC211759

Ingredient ID: NPC210659

Ingredient ID: NPC210623

Ingredient ID: NPC209275

Ingredient ID: NPC208793

Ingredient ID: NPC204120

Ingredient ID: NPC203924

Ingredient ID: NPC200258

Ingredient ID: NPC200129

Ingredient ID: NPC198658

Ingredient ID: NPC196490

Ingredient ID: NPC195749

Ingredient ID: NPC194519

Ingredient ID: NPC193180

Ingredient ID: NPC192671

Ingredient ID: NPC190810

Ingredient ID: NPC189853

Ingredient ID: NPC189248

Ingredient ID: NPC189036

Ingredient ID: NPC187158

Ingredient ID: NPC184580

Ingredient ID: NPC18449

Ingredient ID: NPC18188

Ingredient ID: NPC181465

Ingredient ID: NPC180871

Ingredient ID: NPC180684

Ingredient ID: NPC179088

Ingredient ID: NPC178223

Ingredient ID: NPC177112

Ingredient ID: NPC173996

Ingredient ID: NPC173582

Ingredient ID: NPC172676

Ingredient ID: NPC166904

Ingredient ID: NPC166894

Ingredient ID: NPC166362

Ingredient ID: NPC165695

Ingredient ID: NPC162282

Ingredient ID: NPC16208

Ingredient ID: NPC160607

Ingredient ID: NPC157944

Ingredient ID: NPC156155

Ingredient ID: NPC154792

Ingredient ID: NPC153046

Ingredient ID: NPC152989

Ingredient ID: NPC150809

Ingredient ID: NPC150329

Ingredient ID: NPC150196

Ingredient ID: NPC147062

Ingredient ID: NPC14682

Ingredient ID: NPC143649

Ingredient ID: NPC141777

Ingredient ID: NPC13991

Ingredient ID: NPC139617

Ingredient ID: NPC139546

Ingredient ID: NPC137958

Ingredient ID: NPC137685

Ingredient ID: NPC13755

Ingredient ID: NPC135836

Ingredient ID: NPC134434

Ingredient ID: NPC134397

Ingredient ID: NPC131981

Ingredient ID: NPC131769

Ingredient ID: NPC131642

Ingredient ID: NPC131482

Ingredient ID: NPC126935

Ingredient ID: NPC126681

Ingredient ID: NPC126240

Ingredient ID: NPC125169

Ingredient ID: NPC12278

Ingredient ID: NPC12269

Ingredient ID: NPC122487

Ingredient ID: NPC121322

Ingredient ID: NPC120926

Ingredient ID: NPC118791

Ingredient ID: NPC118385

Ingredient ID: NPC115787

Ingredient ID: NPC114682

Ingredient ID: NPC114239

Ingredient ID: NPC112571

Ingredient ID: NPC111992

Ingredient ID: NPC111247

Ingredient ID: NPC109813

Ingredient ID: NPC109594

Ingredient ID: NPC107482

Ingredient ID: NPC107473

Ingredient ID: NPC105509

Ingredient ID: NPC105238

Ingredient ID: NPC105209

Ingredient ID: NPC10455

Ingredient ID: NPC10407

Ingredient ID: NPC103342

Ingredient ID: NPC10251

Ingredient ID: NPC102449

Ingredient ID: NPC100570