• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Ulva Pertusa


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GAAACCGATCAAACCACTCACAGAGCACCTGCGGGCCCCCTGCGGGCCCGCCGTAGTGAACCAGGAGCCCGGCCGCGTCGGCGCGTGCCCGCAACCCCCGGCATCCGGGGGCCGGCCGCGTCTGGCGCGCTGGGCCCTGTCCAACGCAACAAACCCTCTGCCCTGAAGCAGCTTCGCAAGGGGACACCCCGCGCGACGTTAACTGAGACAACTCTCAACAACGGATATCTTGGCTCTCGCAACGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCCGTGAGTCATCGAATCTTTGAACGCACATTGCCGGTCGACTCTCCGGAGGAGACCACATCTGCCTCAGCGTCGGAATACCCCCTCACGCGGCCGCGTCTCTGGACGCGGCGCGTGGAGCTGGCCCCCCCGGCCTGCGTCTCTCGACGCGGGCCGGGCCGGCTGAAATGCAGAGGCTCGTCCGCGGCCCACTCAGTGGCCCCGACTAGGTAGGTAGCTCGCTACTGCTAGGCGGCGGCCCGGTGCTGCGGGCTCTGGGCCCAAAGGATACCCCCAT

Click for details-----ITS1

GTGAACCTGCGGAGGGATCATTGAAACCGATCAATCCACTCACAGAGCACCAGCGGGCCCCGGCCCGCCGTAGTTTGGATCCGCCGGTCCTCCTGGCCCCCCCCCGGGGGGCCGGGGGCCGGCCGGAGCCTCAACCCAGCCAACCCTCTGCCCTGAAGCAGCTTCGCACGGGGACACCCCTGCGACGTTAACCAGAGA

Click for details-----ITS2

TAACCCCTCACGCGCTTGCGCGTGGACCTGGCCCCCCCGGTCACTGGCCCCCGTGCCAGCCGGGCCGGCTGAAATACAGAGGCTCGCGCGCGGCCCATTCGCGGCCCCGACTAGGTAGGTAGCTCGCTACTCCTACGGCGGAGGCTCGGCGTCGCGTGCTGTGAGCCACGAAGGATACCCACTATTCATTCGACCTGAGTCAGGTGAGCAGCCCCA
Taxonomic Information

Plant ID: NPO5665
Plant Latin Name: Ulva Pertusa
Taxonomy Genus: Ulva
Taxonomy Family: Ulvaceae

Plant External Links:

NCBI TaxonomyDB: 3120
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

73 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


47 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

33 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC97117

Ingredient ID: NPC88566

Ingredient ID: NPC85346

Ingredient ID: NPC78500

Ingredient ID: NPC6908

Ingredient ID: NPC61198

Ingredient ID: NPC57879

Ingredient ID: NPC54733

Ingredient ID: NPC5178

Ingredient ID: NPC46225

Ingredient ID: NPC43246

Ingredient ID: NPC39927

Ingredient ID: NPC3649

Ingredient ID: NPC315877

Ingredient ID: NPC314277

Ingredient ID: NPC311988

Ingredient ID: NPC307715

Ingredient ID: NPC292058

Ingredient ID: NPC28318

Ingredient ID: NPC27699

Ingredient ID: NPC27633

Ingredient ID: NPC276009

Ingredient ID: NPC271862

Ingredient ID: NPC271712

Ingredient ID: NPC268221

Ingredient ID: NPC260914

Ingredient ID: NPC257124

Ingredient ID: NPC247671

Ingredient ID: NPC242626

Ingredient ID: NPC238176

Ingredient ID: NPC235059

Ingredient ID: NPC229030

Ingredient ID: NPC22098

Ingredient ID: NPC217226

Ingredient ID: NPC214776

Ingredient ID: NPC214770

Ingredient ID: NPC214532

Ingredient ID: NPC209970

Ingredient ID: NPC20903

Ingredient ID: NPC204491

Ingredient ID: NPC203719

Ingredient ID: NPC20220

Ingredient ID: NPC197316

Ingredient ID: NPC194175

Ingredient ID: NPC193417

Ingredient ID: NPC190742

Ingredient ID: NPC18844

Ingredient ID: NPC187738

Ingredient ID: NPC187605

Ingredient ID: NPC187011

Ingredient ID: NPC180058

Ingredient ID: NPC174368

Ingredient ID: NPC17425

Ingredient ID: NPC165651

Ingredient ID: NPC162301

Ingredient ID: NPC161774

Ingredient ID: NPC161193

Ingredient ID: NPC158278

Ingredient ID: NPC156461

Ingredient ID: NPC151976

Ingredient ID: NPC14930

Ingredient ID: NPC14786

Ingredient ID: NPC147446

Ingredient ID: NPC140310

Ingredient ID: NPC137590

Ingredient ID: NPC133435

Ingredient ID: NPC126708

Ingredient ID: NPC120233

Ingredient ID: NPC118170

Ingredient ID: NPC117237

Ingredient ID: NPC115087

Ingredient ID: NPC110234

Ingredient ID: NPC106770