• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Osyris Abyssinica


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ATTATGCTGCTCCTCGTGCTTTCCCTATTTTAAGGGGGAAGGTCCTAGGAGCGAAGGTTGGTTTCCCGTGCAATAATTGTGCGGTTAGCTAAAATATATAGTCCTTGGCGACACGCCTCATGACGAGTTGTGGATAACAGCGTTGGCGTTGTGTTACCAAGTGAAGAGATATAAGACTCTTGGACTCCTTCACCTCGTGAGAATGGAACTCCTT
Taxonomic Information

Plant ID: NPO5633
Plant Latin Name: Osyris Abyssinica
Taxonomy Genus: Osyris
Taxonomy Family: Santalaceae

Plant External Links:

NCBI TaxonomyDB: n.a.
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

34 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


13 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

12 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99011

Ingredient ID: NPC9874

Ingredient ID: NPC87465

Ingredient ID: NPC81559

Ingredient ID: NPC67037

Ingredient ID: NPC37250

Ingredient ID: NPC308905

Ingredient ID: NPC307052

Ingredient ID: NPC298124

Ingredient ID: NPC282468

Ingredient ID: NPC281131

Ingredient ID: NPC274891

Ingredient ID: NPC272721

Ingredient ID: NPC264544

Ingredient ID: NPC262826

Ingredient ID: NPC251102

Ingredient ID: NPC245673

Ingredient ID: NPC243924

Ingredient ID: NPC233576

Ingredient ID: NPC212064

Ingredient ID: NPC210298

Ingredient ID: NPC208385

Ingredient ID: NPC173637

Ingredient ID: NPC172194

Ingredient ID: NPC157378

Ingredient ID: NPC144449

Ingredient ID: NPC134819

Ingredient ID: NPC133757

Ingredient ID: NPC133671

Ingredient ID: NPC119472

Ingredient ID: NPC118441

Ingredient ID: NPC114622

Ingredient ID: NPC112607

Ingredient ID: NPC111455