CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Crotalaria Aegyptiaca

Example Image

PLANiTS DNA barcode

Click for details-----ITS

GAAGCCTCGCNAGCAGTGCGACCCGTGGATTTGTTTGACATGTGAGGGGATGGCTAGAGGCGTTCTCGTCCTCGGTCCCCCCCTCGTGTCGGGAGGCGCCACACCTTGTGTGGCATCCTCTCGTTTGAATAACAAAAACCCGGCGCTGAATGCGCCAAGGAGATCAAAATCGTTTAGTGCACCCCCGTGGGCTCGGAGACGGTGCTTGTGCGGGCGGTGATGCGACACGCGTATCCGAAGGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGCCTGCCTGGGTGTCGCCCATCGTTGCCCCAGTGCCTTGGCCTCATGCTAGGCACCGAGCTGGGCGAATGCTGGCTTCCCGTGAGCAAAGCCTCACGGTTGGTTTAAAATTGAGTCCGTGGTGGGTGGCACCGTGGCGGATGGTGGTTGAGTAAGTGAAAGCTTGAGACCCATCGTGGTTGTCACCCTCACCGGCATTTGGACTCTATGATCCATGAGCGTCTGTTGGTCGCCCATGACGGGACCTCA

Click for details-----ITS1

Click for details-----ITS2

Taxonomic Information

Plant ID: NPO5541
Plant Latin Name: Crotalaria Aegyptiaca
Taxonomy Genus: Crotalaria
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: n.a.
Plant-of-the-World-Online: 487765-1

Used in Medicines

Unknown.

Geographical Distribution

Saudi Arabia; Egypt; Oman; India; United States; Sudan; Somalia; Yemen

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

36 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

0 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

24 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC881

Ingredient ID: NPC77672

Ingredient ID: NPC64135

Ingredient ID: NPC58190

Ingredient ID: NPC43123

Ingredient ID: NPC40602

Ingredient ID: NPC37798

Ingredient ID: NPC37793

Ingredient ID: NPC37668

Ingredient ID: NPC302857

Ingredient ID: NPC293344

Ingredient ID: NPC281131

Ingredient ID: NPC280945

Ingredient ID: NPC27973

Ingredient ID: NPC278068

Ingredient ID: NPC268266

Ingredient ID: NPC253662

Ingredient ID: NPC252979

Ingredient ID: NPC247434

Ingredient ID: NPC220825

Ingredient ID: NPC219876

Ingredient ID: NPC212628

Ingredient ID: NPC201814

Ingredient ID: NPC194454

Ingredient ID: NPC180474

Ingredient ID: NPC178134

Ingredient ID: NPC172419

Ingredient ID: NPC168579

Ingredient ID: NPC126029

Ingredient ID: NPC114791

Ingredient ID: NPC114242

Ingredient ID: NPC109245

Ingredient ID: NPC108455

Ingredient ID: NPC105799

Ingredient ID: NPC104222

Ingredient ID: NPC102121

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Enzyme	APEX1	DNA-(apurinic or apyrimidinic site) lyase	P27695	CHEMBL5619
Therapeutic Target	Enzyme	NOX4	NADPH oxidase 4	Q9NPH5	CHEMBL1250375
Therapeutic Target	Enzyme	ALPL	Alkaline phosphatase, tissue-nonspecific isozyme	P05186	CHEMBL5979
Therapeutic Target	Enzyme	RECQL	ATP-dependent DNA helicase Q1	P46063	CHEMBL1293236
Therapeutic Target	Enzyme	POLB	DNA polymerase beta	P06746	CHEMBL2392
Therapeutic Target	Enzyme	HPGD	15-hydroxyprostaglandin dehydrogenase [NAD+]	P15428	CHEMBL1293255
Therapeutic Target	Isomerase	P4HB	Protein disulfide-isomerase	P07237	CHEMBL5422
Therapeutic Target	Other cytosolic protein	HSPA1A	Heat shock 70 kDa protein 1	P0DMV8	CHEMBL5460
Therapeutic Target	Oxidoreductase	AKR1B1	Aldose reductase	P15121	CHEMBL1900
Therapeutic Target	Phosphodiesterase	TDP1	Tyrosyl-DNA phosphodiesterase 1	Q9NUW8	CHEMBL1075138
Therapeutic Target	Protein Kinase	MET	Hepatocyte growth factor receptor	P08581	CHEMBL3717
Therapeutic Target	Protein Kinase	SRC	Tyrosine-protein kinase SRC	P12931	CHEMBL267
Therapeutic Target	Protein Kinase	KDR	Vascular endothelial growth factor receptor 2	P35968	CHEMBL279
Therapeutic Target	Protein Kinase	NUAK1	NUAK family SNF1-like kinase 1	O60285	CHEMBL5784
Therapeutic Target	Protein Kinase	EGFR	Epidermal growth factor receptor erbB1	P00533	CHEMBL203
Therapeutic Target	Protein Kinase	CSNK2A1	Casein kinase II alpha	P68400	CHEMBL3629
Therapeutic Target	Protein Kinase	IGF1R	Insulin-like growth factor I receptor	P08069	CHEMBL1957
Therapeutic Target	Protein Kinase	INSR	Insulin receptor	P06213	CHEMBL1981
Therapeutic Target	Protein Kinase	TEK	Tyrosine-protein kinase TIE-2	Q02763	CHEMBL4128
Therapeutic Target	Protein Phosphatase	PTPN2	T-cell protein-tyrosine phosphatase	P17706	CHEMBL3807
Therapeutic Target	Serine protease	F10	Coagulation factor X	P00742	CHEMBL244
Therapeutic Target	Serine protease	DPP4	Dipeptidyl peptidase IV	P27487	CHEMBL284
Drug Transporter	SLC superfamily of solute carriers	SLC22A6	Solute carrier family 22 member 6	Q4U2R8	CHEMBL1641347
Therapeutic Target	Small molecule receptor (family A GPCR)	GPR35	G-protein coupled receptor 35	Q9HC97	CHEMBL1293267
Therapeutic Target	Transcription factor	NFKB1	Nuclear factor NF-kappa-B p105 subunit	P19838	CHEMBL3251
Therapeutic Target	Transcription factor	SMAD3	Mothers against decapentaplegic homolog 3	P84022	CHEMBL1293258
Therapeutic Target	Transferase	POLI	DNA polymerase iota	Q9UNA4	CHEMBL5391
Therapeutic Target	Transferase	POLH	DNA polymerase eta	Q9Y253	CHEMBL5542

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	11

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT03236662	(-)- Epicatechin Becker Muscular Dystrophy	Becker muscular dystrophy	(-)-Epicatechin (NPC126029)	NP level
NCT02621060	Effect of Chlorogenic Acid on Patients With Impaired Glucose Tolerance	abnormal glucose tolerance	Chlorogenic Acid (NPC302857)	NP level
NCT04011618	Effect of Ellagic Ácid on the Components of Metabolic Syndrome, Insulin Sensitivity and Insulin Secretion	metabolic syndrome	Ellagic Acid (NPC178134)	NP level
NCT02728349	Tolerance and Pharmacokinetic Study of Chlorogenic Acid to Advanced Glioblastoma	glioblastoma multiforme	Chlorogenic Acid (NPC302857)	NP level
NCT01856868	Use of (-)-Epicatechin in the Treatment of Becker Muscular Dystrophy (Pilot Study)	Becker muscular dystrophy	(-)-Epicatechin (NPC126029)	NP level
NCT03751592	Phase Ib/IIa Studies of Chlorogenic Acid for Injection for Safety and Efficacy of Advanced Lung Cancer	lung cancer	Chlorogenic Acid (NPC302857)	NP level
NCT02245204	Phase I Studies of Chlorogenic Acid for Injection for Tolerance and Pharmacokinetic of Advanced Cancers	cancer	Chlorogenic Acid (NPC302857)	NP level
NCT02136342	Phase 1 Trial of Chlorogenic Acid in Patients With Advanced Cancer	cancer	Chlorogenic Acid (NPC302857)	NP level
NCT00455416	Dietary Intervention in Follicular Lymphoma	follicular lymphoma	Ellagic Acid (NPC178134)	NP level
NCT03758014	Studies of Chlorogenic Acid for Injection for Safety and Efficacy of Grade IV GBM Patients	glioblastoma multiforme	Chlorogenic Acid (NPC302857)	NP level
NCT01880866	(-)-Epicatechin and Pulmonary Arterial Hypertension	pulmonary arterial hypertension	(-)-Epicatechin (NPC126029)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	CSNK2A1,NUAK1,SRC,AKR1B1,SMAD3,IGF1R,GPR35,ELAVL3,NOX4
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	DPP4,RECQL,NUAK1,F10,POLB,TEK,MET,SNCA,ANTXR2
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	DPP4,PTPN2,GALNT2,AKR1B1,HSD17B10,NFKB1,HPGD,APEX1
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	EGFR,IGF1R,SRC,TEK,MET,KDR
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	NUAK1,SRC,AKR1B1,IGF1R,GPR35,NOX4
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	DPP4,F10,HPGD,SNCA,MET,NOX4
Stomach cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	HSPA1A,KDR,EGFR,MET,HSPA1B
Liver cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12	MET,CSNK2A1,EGFR,KDR,IGF1R
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	IGF1R,MET,KDR,EGFR NCT03751592
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	F10,ELAVL3,SNCA,MET,NOX4
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	DPP4,SRC,INSR,F10,SNCA
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	DPP4,MET,KDR,POLH,ANTXR2
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	KDR,SRC,EGFR,MET
Malignant digestive organ neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C11	KDR,HSPA1A,SRC,HSPA1B
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	INSR,MET,KDR,SNCA
Motor neuron disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B60	IGF1R,HSPA1B,HSPA1A,SRC
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	EGFR,MET,KDR,IGF1R
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	AKR1B1,DPP4,INSR,KDR
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	KDR,IGF1R,INSR,SRC
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	DPP4,AKR1B1,NOX4,ALPL
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	NOX4,SLC22A6,GPR35,SRC
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	KDM4E,HPGD,GPR35,ELAVL3
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	DPP4,MET,NOX4,ALPL
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	DPP4,SMAD3,ANTXR2,NOX4
Non-small cell lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	MET,KDR,EGFR
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	MET,SRC,KDR
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	HSPA1B,AKR1B1,HSPA1A
Retinopathy Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B71	IGF1R,APEX1,TEK
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	NFKB1,INSR,DPP4
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	IGF1R,EGFR,SRC
Pleomorphic sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B54	SRC,KDR,MET
Head and neck cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D42	MET,EGFR,KDR
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	EGFR,MET,KDR
BCR-ABL1-negative chronic myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A41	HSPA1A,SRC,HSPA1B
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	TEK,MET,DPP4
Herpes simplex infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F00	HSPA1B,HSPA1A,SMAD3
Metastatic lymph node neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60	MET,EGFR,KDR
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	IGF1R,AKR1B1,INSR
Diabetic foot ulcer Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD54	HSPA1A,EGFR,HSPA1B
Melanoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	KDR,EGFR,MET
Ovarian cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73	KDR,SRC,MET
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	DPP4,INSR,NFKB1
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	NFKB1,MET,DPP4
Mature B-cell leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A82	SRC,EGFR
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	DPP4,SRC
Gastrointestinal stromal tumour Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5B	KDR,SRC
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	NFKB1,AKR1B1
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	INSR ALPL
Metabolic disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5D2Z	DPP4 NCT04011618
Ischemia Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B10-8B11	EGFR,SRC
Chronic pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG30	KDR,EGFR
Peritoneal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C51	KDR,SRC
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	SRC,NFKB1
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	EGFR,KDR
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	F10,AKR1B1
Unspecific body region injury Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: ND56	MET,EGFR
NA Disease Category: NA Disease ICD-11 Code: NA	MET,NOX4
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	SRC,NFKB1
Myeloproliferative neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A20	SRC,TEK
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	SNCA,SRC
Thyroid cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10	MET,KDR
Metastatic malignant neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D50-2E09	HSPA1B,HSPA1A
Colon cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90	ALPL,EGFR
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	DPP4,NFKB1
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	MET,AKR1B1
Becker muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70.0	NCT03236662,NCT01856868
Unspecified malignant neoplasms of unspecified sites Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D4Z	NCT02245204,NCT02136342
Glioblastoma, primary, NOS Disease Category: X.Extension Codes Disease ICD-11 Code: XH0MB1	NCT02728349,NCT03758014
Inflammatory bowel diseases, unspecified Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD7Z	NOX4,ALPL
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	NOX4,MET
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	MET,GPR35
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	MET,NOX4
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	IGF1R,NOX4
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	HSPA1A,NOX4
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	GPR35,ALPL
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	EGFR,GPR35
Polycystic ovary syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80.1	HPGD,POLH
Human immunodeficiency virus disease without mention of tuberculosis or malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C62	MET,GPR35
Gliomas of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.0	ANTXR2,NOX4
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	RECQL,HSD17B10,EGFR,APEX1,MET,TDP1,AKR1B1,KDR,SRC,CSNK2A2,CSNK2A1,NUAK1,TEK,F10,POLH,NOX4
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	DPP4,RECQL,TDP1,GALNT2,PTPN2,SRC,EGFR,HPGD,CSNK2A2,KDR,SNCA,APEX1,POLH,MET,P4HB
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	IGF1R,HSPA1B,POLB,PTPN2,NFKB1,CSNK2A1,APEX1,EGFR,HSPA1A,MET,TEK,KDR,SRC
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	DPP4,PTPN2,NUAK1,AKR1B1,SMAD3,TEK,HPGD,SLC22A6,KDR,SNCA,MET,NOX4
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	DPP4,TDP1,GALNT2,POLB,HSD17B10,AKR1B1,ELAVL3,MET,ALPL,P4HB
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	CSNK2A1,TDP1,HPGD,ELAVL3,APEX1,POLH,MET,NOX4,ALPL,P4HB
Supraventricular tachyarrhythmia Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC81	F10
Type-1/2 diabete Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A10-5A11	INSR
Postoperative inflammation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-CA43	SRC
Hepatitis virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E50-1E51	EGFR
Intracerebral haemorrhage Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B00	EGFR
Genetic prion disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E02	ALPL
Fallopian tube cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C74	SRC
Autism spectrum disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A02	DPP4
Coagulation defect Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B10	F10
Malignant mesenchymal neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5D-2B5Y	EGFR
Skin postprocedural disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EL8Y	EGFR
Angina pectoris Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40	EGFR
Fungal infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F29-1F2F	NFKB1
Urethral cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C93	EGFR
Irritable bowel syndrome Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD91	NFKB1
Autonomic nervous system disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8D87	SNCA
Endometrial cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76	SRC
Extraocular muscle disorder Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C82	IGF1R
Leiomyosarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B58	SRC
Pituitary gland disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A60-5A61	IGF1R
Liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB90-DB9Z	MET
Coronary thrombosis Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA43	F10
Deep vein thrombosis Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD71	F10
Metastatic biliary tract neoplasms Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C14-2C17	EGFR
Biliary tract cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C17	MET
Venous thromboembolism Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD72	F10
Cerebral ischaemia Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B1Z	F10
Digestive organ benign neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2E92	KDR
Mature B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A85	TEK
Lysosomal disease Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C56	INSR
Epidermal dysplasias Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EK90	SRC
Osteosarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B51	SRC
Testicular cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80	EGFR
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	IGF1R
Coronavirus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D92	CSNK2A1
Bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20-GA21	F10
Cataract Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B10	AKR1B1
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	EGFR
Spinal cord/cranial nerve neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A02	EGFR
Ocular cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D00-2D07	APEX1
Psychotic disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20-6A25	INSR
Ischemic heart disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40-BA6Z	MET
Christmas disease Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B11	F10
Multiple structural anomalies syndrome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD2F	IGF1R
Attention deficit hyperactivity disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A05	F10
Lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40	NFKB1
Synovial sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5A	SRC
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	DPP4
Skin and skin-structure infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F28-1G0Z	NFKB1
Choreiform disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A01	NFKB1
Nasopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6B	EGFR
Muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70	NFKB1
Parasitic infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D0Y-1G2Z	ALPL
Cervical cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C77	SRC
Hypopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6D	EGFR
Metastatic digestive system neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D8Y	SRC
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	NFKB1
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	NFKB1
Acute/subacute hepatic failure Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB91	NFKB1
Thyrotoxicosis Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A02	IGF1R
Blood-forming organ disease Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3C0Z	F10
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	AKR1B1
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	KDR
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	NCT01880866
Follicular lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A80	NCT00455416
Impaired glucose tolerance Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A40.1	NCT02621060
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	SMAD3
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	ALPL
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	NOX4
Myotonic dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71.0	HPGD
Pneumonia due to Pseudomonasaeruginosa Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA40.05	DPP4
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	AKR1B1
Systemic sclerosis Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A42	NOX4
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	NOX4
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	GPR35
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	ELAVL3
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	MET
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	MET
Lyme borreliosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C1G	MET

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Crotalaria Aegyptiaca

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

36 All known Ingredients in Total

0 Ingredients with Acceptable Bioavailablity

24 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Malignant neoplasms of biliary tract, distal bile duct

Adenocarcinoma of pancreas

Malignant neoplasms of thymus

Breast cancer

Hepatoblastoma

Malignant neoplasms of adrenal gland

Stomach cancer

Liver cancer

Lung cancer

Pheochromocytoma

Superficial ovarian endometriosis

Glioblastoma of brain

Brain cancer

Malignant digestive organ neoplasm

Alzheimer disease

Motor neuron disease

Colorectal cancer

Acute diabete complication

Multiple myeloma

Leishmaniasis

Hepatocellular carcinoma of liver

Cytomegaloviral disease

Malignant neoplasms of thyroid gland, unspecified

Carpal tunnel syndrome

Non-small cell lung cancer

Cardiovascular disease

Neuropathy

Retinopathy

Diabetes mellitus, type unspecified

Pancreatic cancer

Pleomorphic sarcoma

Head and neck cancer

Renal cell carcinoma

BCR-ABL1-negative chronic myeloid leukaemia

Chronic arterial occlusive disease

Herpes simplex infection

Metastatic lymph node neoplasm

Pain, unspecified

Diabetic foot ulcer

Melanoma

Ovarian cancer

Type 2 diabetes mellitus

West Nile virus infection

Mature B-cell leukaemia

Malignant haematopoietic neoplasm

Gastrointestinal stromal tumour

Rheumatoid arthritis

Crohn disease

Metabolic disorder

Ischemia

Chronic pain

Peritoneal cancer

Multiple sclerosis

Myelodysplastic syndrome

Thrombosis

Unspecific body region injury

NA

Acute myeloid leukaemia

Myeloproliferative neoplasm

Parkinsonism

Thyroid cancer

Metastatic malignant neoplasm

Colon cancer

Psoriasis