• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Populus Tremula


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

GAACCCGTGGCATGACAAGCTGGGCTTGGGGGGCACCCGCCCTTCGCGTCCTTGCGGGCCGTGGAGGGATGCATATACACCCTGCACAGCTCGCAAACGAACCGCGGCACAAGAAACGCCAAGGAAATTGAGTACTAAGAGCACGCCCTCGTAGCCTCGGCGTTGGGGGCGTGCCTTCTTTTGGTGATAATCTAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO5511
Plant Latin Name: Populus Tremula
Taxonomy Genus: Populus
Taxonomy Family: Salicaceae

Plant External Links:

NCBI TaxonomyDB: 113636
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Turkey; Sweden; Finland; Lebanon

Traditional Medicine System:


Medicinal Functions:

Anodyne; Antiinflammatory; Bach; Diuretic; Expectorant; Febrifuge; Stimulant

Geographical Distribution

Turkey; Sweden; Finland; Lebanon

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

75 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


14 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

35 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9634

Ingredient ID: NPC90769

Ingredient ID: NPC88740

Ingredient ID: NPC85376

Ingredient ID: NPC82847

Ingredient ID: NPC81698

Ingredient ID: NPC77719

Ingredient ID: NPC7095

Ingredient ID: NPC69394

Ingredient ID: NPC6332

Ingredient ID: NPC60509

Ingredient ID: NPC57030

Ingredient ID: NPC35659

Ingredient ID: NPC306799

Ingredient ID: NPC304876

Ingredient ID: NPC300414

Ingredient ID: NPC295835

Ingredient ID: NPC2907

Ingredient ID: NPC288230

Ingredient ID: NPC288056

Ingredient ID: NPC286146

Ingredient ID: NPC279370

Ingredient ID: NPC275861

Ingredient ID: NPC265395

Ingredient ID: NPC26033

Ingredient ID: NPC257213

Ingredient ID: NPC256142

Ingredient ID: NPC251407

Ingredient ID: NPC250696

Ingredient ID: NPC250046

Ingredient ID: NPC249983

Ingredient ID: NPC249471

Ingredient ID: NPC249375

Ingredient ID: NPC242262

Ingredient ID: NPC241278

Ingredient ID: NPC237549

Ingredient ID: NPC233806

Ingredient ID: NPC233196

Ingredient ID: NPC228204

Ingredient ID: NPC221482

Ingredient ID: NPC213552

Ingredient ID: NPC213285

Ingredient ID: NPC208380

Ingredient ID: NPC205522

Ingredient ID: NPC201773

Ingredient ID: NPC199816

Ingredient ID: NPC199067

Ingredient ID: NPC198539

Ingredient ID: NPC198455

Ingredient ID: NPC187861

Ingredient ID: NPC186708

Ingredient ID: NPC183542

Ingredient ID: NPC18074

Ingredient ID: NPC178177

Ingredient ID: NPC175580

Ingredient ID: NPC165260

Ingredient ID: NPC163699

Ingredient ID: NPC160951

Ingredient ID: NPC15917

Ingredient ID: NPC158333

Ingredient ID: NPC156913

Ingredient ID: NPC154819

Ingredient ID: NPC14958

Ingredient ID: NPC131874

Ingredient ID: NPC131698

Ingredient ID: NPC127857

Ingredient ID: NPC124578

Ingredient ID: NPC121712

Ingredient ID: NPC1173

Ingredient ID: NPC114410

Ingredient ID: NPC112523

Ingredient ID: NPC112216

Ingredient ID: NPC10776

Ingredient ID: NPC104863

Ingredient ID: NPC101043