CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Juniperus Drupacea

Example Image

PLANiTS DNA barcode

Click for details-----ITS

CATTGTCGGTTCGAGACCCTGAATCGTGTAGGGGACGGAGCTCGCCTCCCTCCCCGCCCCCAAAATCTCGGCGACGTGCGGACACTTGGCCCTGCAGCGATGTGCTGGACGGCCAAGCTAAAGGGTCCCGCGCCGTCGCGGTCGAGGGTCATCGAATGCCGCGATCGAAAGCGTGGATTCCCCGCGGTGCGAGGAGACTCGGATGTAAAATCTGGATCACAACTGGTGCCTTCGAACGACGTCTACGTCGCAGCGAGCGGTCCCTGCTCGGTTGTAGTTCAGAGGAGGTCCGGGCCTCATCCCCCGTTGAGATTTCATGGCTCGGTCGTGTGCGCGGCGCTGTGCCAGGGATCCGTCGATTCGTCGGCGGCAAGTCGGGACTGCCGCAACCCTCCGTTGCGTTGCTCTGGTGTTAACTCGCCGCTGGGAGCGTTTTGTGTTCAGGAAGGGTGCACTCGCATGATCTGCGTGGCAGGGGCCCCCGTCCGACGACACGACTCTCCCTTGCGGCGACTCACACACCTTTTGCGAGGTGATGGGGCGGGGACACACCACAGCGTTCTCCGTCGCACCCGTCGGGTGCTCGGAGGGCGGGATGTGTCAACACCCAACACACGGGTGTGCATCGCGCACCTTAGAAATCCAAAAGAATGAAGTGCGATCGAGCGCCTTGTGCGCTTGGGTCGGACGAAAGAGAAAAAAACATAACGAAATCACGACTCTCGGCAACGGATATCTCGGCTCTCGCCACGATGAAGAATGTAGCGAAATGCGATACTTAGTGTGAATTGCAGAATCCCGTGAATCATCAAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTCGGCCAAGGGCACGTCTGCTTGGGCGTCGCACTCCAAAATTGCCCTCCCCCGCGAGGAGCGTAGATGGCCGTCCGTGTCCGCAAGCGGGGCGGTCGGCTGAAATGAGCACGAGGTCCGTCGATCCGTCGCGACGAGCGGTGGTTCCCAAAGGCCGGCGTTGGTTTGCGCTGATCGAACGATGCCTCGTGTGGAACTTTATCTTTGGTGCCACGGCCCGCCATAGTGCGGGCATGGTGCCATCTCTACCGCGTCC

Click for details-----ITS1

Click for details-----ITS2

TCCAAAATTGCCCTCCCCCGCGAGGAGCGTAGATGGCCGTCCGTGTCCGCAAGCGGGGCGGTCGGCTGAAATGAGCACGAGGTCCGTCGATCCGTCGCGACGAGCGGTGGTTCCCAAAGGCCGGCGTTGGTTTGCGCTGATCGAACGATGCCTCGTGTGGAACTTTATCTTTGGTGCCACGGCCCGCCATAGTGCGGGCATGGTGCCATCTCTACCGCGTCC

Taxonomic Information

Plant ID: NPO5456
Plant Latin Name: Juniperus Drupacea
Taxonomy Genus: Juniperus
Taxonomy Family: Cupressaceae

Plant External Links:

NCBI TaxonomyDB: 103973
Plant-of-the-World-Online: n.a.

Geographical Distribution

−

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 1	CYP1A1	Cytochrome P450 1A1	P04798	CHEMBL2231
Cytochrome P450	Cytochrome P450 family 1	CYP1B1	Cytochrome P450 1B1	Q16678	CHEMBL4878
Cytochrome P450	Cytochrome P450 family 1	CYP1A2	Cytochrome P450 1A2	P05177	CHEMBL3356
Drug Transporter	ATP-binding cassette	ABCG2	ATP-binding cassette sub-family G member 2	Q9UNQ0	CHEMBL5393
Therapeutic Target	Aspartic protease	BACE1	Beta-secretase 1	P56817	CHEMBL4822
Therapeutic Target	Enzyme	ALOX12	Arachidonate 12-lipoxygenase	P18054	CHEMBL3687
Therapeutic Target	Enzyme	POLB	DNA polymerase beta	P06746	CHEMBL2392
Therapeutic Target	Enzyme	NOX4	NADPH oxidase 4	Q9NPH5	CHEMBL1250375
Therapeutic Target	Hydrolase	ACHE	Acetylcholinesterase	P22303	CHEMBL220
Therapeutic Target	Lyase	CA2	Carbonic anhydrase II	P00918	CHEMBL205

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT00455416	Dietary Intervention in Follicular Lymphoma	follicular lymphoma	Quercetin (NPC20791)	NP level
NCT01348204	Nasal Potential Studies Utilizing Cystic Fibrosis Transmembrane Regulator (CFTR) Modulators	cystic fibrosis	Quercetin (NPC20791)	NP level
NCT01375101	Therapeutic Effect of Quercetin and the Current Treatment of Erosive and Atrophic Oral Lichen Planus	oral lichen planus	Quercetin (NPC20791)	NP level
NCT01438320	Q-Trial in Patients With Hepatitis C	chronic hepatitis C virus infection	Quercetin (NPC20791)	NP level
NCT01705652	Study to Assess the Activity of Nexrutine® in Prostate Cancer Patients	prostate cancer	Rutin (NPC176740)	NP level
NCT01708278	Beneficial Effects of Quercetin in Chronic Obstructive Pulmonary Disease (COPD)	chronic obstructive pulmonary disease	Quercetin (NPC20791)	NP level
NCT01720147	Quercetin in Children With Fanconi Anemia; a Pilot Study	Fanconi anemia	Quercetin (NPC20791)	NP level
NCT01839344	Effects of Quercetin on Blood Sugar and Blood Vessel Function in Type 2 Diabetes.	type 2 diabetes mellitus	Quercetin (NPC20791)	NP level
NCT01912820	Effect of Quercetin on Green Tea Polyphenol Uptake in Prostate Tissue From Patients With Prostate Cancer Undergoing Surgery	prostate adenocarcinoma	Quercetin (NPC20791)	NP level
NCT02226484	Can Quercetin Increase Claudin-4 and Improve Esophageal Barrier Function in GERD?	gastroesophageal reflux disease	Quercetin (NPC20791)	NP level

Associated Disease of the Plant	Association Type & Detailed Evidence
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	AKR1B1,AURKB,KDR,DPP4
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	AXL,SRC,AURKB,PIM1,FLT3,TP53
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	OPRD1,THPO,NPSR1,AURKB,CA12,ACHE,CDK1,XDH,CA7,TTR
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	ALOX5,CYP1B1,NPSR1,CA7,TTR,ALOX15,ABCG2,SNCA,PIM1,RECQL,DPP4,POLB,CA2,AXL,AURKB,MET,ACHE,XDH
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	NOX4,TTR,ALOX15 NCT01912820
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	NPSR1,AURKB,NOX4,CYP19A1,MET,CDK1,ALOX15
Ageing associated decline in intrinsic capacity Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG2A	NCT04946383,NCT05422885
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	MET,ACHE,FLT3,SNCA,BACE1,KDR,ESR2
Amyloidosis Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5D00	TTR
Angina pectoris Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40	EGFR

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Juniperus Drupacea

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

239 All known Ingredients in Total

161 Ingredients with Acceptable Bioavailablity

75 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Acute diabete complication

Acute myeloid leukaemia

Adenocarcinoma of bronchus or lung

Adenocarcinoma of pancreas

Adenocarcinoma of prostate

Adenocarcinoma of stomach

Ageing associated decline in intrinsic capacity

Alzheimer disease

Amyloidosis

Angina pectoris

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities