• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Veronica Chamaedrys


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCATTGTCGAACCCTGTAACCCGACCGCGAACACGTGTTAATCAACTCGCCAGACGGGCGCTTGCGTCCGGACGGCTCACGAACCCCGGCGCGGAAAGCGCCAAGGAAAACTACAAGGAATCGTCGCCCCTAGGACGCCCGTCCGCGGTGCGCCCTGGGCGCGCGACGTCCCTAAAAATGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCTCCAACGTCCCCAGGGACTCGCGAGAGGGAGCGGAAAATGGTCTCCCGTGTGCCTTCTGGCCCGCGGCTGGCCTAAATGAGATCCTGCATCGACGGATGTCACGACCAGTGGTGGTTGAAAACTCAATCGGGCTGTCGTGCGTCGACTCGTCGCTTGCCGTTTCCTCGAACCGAACGGCGCCTCGCGCGCCCACGACCGCGACCCCAGGTCAGGCGGGA

Click for details-----ITS1

TCGAACCCTGTAAACCTGACCGCGAACATGTGTTAATCAACTCGCCAGACGGGCGCTTGCGTCCGGACGGCTCACGAACCCCGGCGCGGAAAGCGCCAAGGAAAACTACAAGGAATCGTCGCCCCTAGGACGCCCGTCCGCGGTGCGCCCTGGGCGCGCGACGTCCCTAAAAATGTCTAAA

Click for details-----ITS2

ATCGCGTCGCCCCCCTCCAACGTCCCTAGGGACTCGCGAGAGGGAGCGGAAAATGGTCTCCCGTGTGCCTTCTGGCCCGCGGCTGGCCTAAATGAGATCCTGCATCGACGGATGTCACGACCAGTGGTGGTTGAAAACTCAATCGAGCTGTCGTGCGTCGACTCGTCGCTTGCCGTTTCCTCGAACCGAACGGCGCCTCGCGCGCCCACGGCCGCGACCCCAGGTCAG
Taxonomic Information

Plant ID: NPO5406
Plant Latin Name: Veronica Chamaedrys
Taxonomy Genus: Veronica
Taxonomy Family: Plantaginaceae

Plant External Links:

NCBI TaxonomyDB: 165330
Plant-of-the-World-Online: 811804-1

Used in Medicines

Country/Region:
Sweden; Finland

Traditional Medicine System:


Medicinal Functions:

Blood purifier; Skin; Vulnerary

Geographical Distribution

Turkey; Italy; France; Ireland; Norway; Belarus; Iceland; Germany; Belgium; Kazakhstan; Spain; Ukraine; Netherlands; Denmark; Poland; Finland; United States; Sweden; Switzerland; Russia; Bulgaria; Romania; Albania; Portugal; South Africa; United Kingdom; Austria; Greece; Hungary

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

35 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


21 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

17 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC60019

Ingredient ID: NPC5286

Ingredient ID: NPC50898

Ingredient ID: NPC49659

Ingredient ID: NPC35141

Ingredient ID: NPC32441

Ingredient ID: NPC312379

Ingredient ID: NPC311142

Ingredient ID: NPC310817

Ingredient ID: NPC307063

Ingredient ID: NPC297931

Ingredient ID: NPC292419

Ingredient ID: NPC289906

Ingredient ID: NPC282169

Ingredient ID: NPC277570

Ingredient ID: NPC270849

Ingredient ID: NPC265551

Ingredient ID: NPC263667

Ingredient ID: NPC262826

Ingredient ID: NPC250260

Ingredient ID: NPC248702

Ingredient ID: NPC237779

Ingredient ID: NPC235621

Ingredient ID: NPC225434

Ingredient ID: NPC212730

Ingredient ID: NPC210003

Ingredient ID: NPC204044

Ingredient ID: NPC196330

Ingredient ID: NPC190987

Ingredient ID: NPC179950

Ingredient ID: NPC174396

Ingredient ID: NPC16899

Ingredient ID: NPC124183

Ingredient ID: NPC123965

Ingredient ID: NPC120150