• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Citrus X Paradisi


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TTTGTTGAAACCTACCCAACAGAATAAGAACATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACCAGTTGATATCACCGGCGGCGGGAGGGGGTGCGCGTCCGCAACGGGCGCTCCTCCTTCCCGCCCCATGCCGCGGGAGAGAGGGACTCGTCCCGCTCCTGGCTGGCGAAACAACGAACCCCCGGCGCGGACTGCGCCAAGGAAATCTAACGAGAGAGCACGCTCCCGCGGCCCCGGAGACGGTGCGCCGCGGGGTGCGGCGCCTTCTTTCACATGTATCCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTGCCCCACCCCACCCCCCCAAACCAAGGCGGGGGCCCCGGGGTGCGGGCGGAGATTGGCCTCCCGTGCGCTGACCGCTYGCGGTTGGCCCAAATWTGAGTCCTCGGCGACCGAAGCCGCGGCGATCGGTGGTGAAACAAAAGCCTCTCGAGCTCCCGCCGCGCGCCCGGTCTCCAAGTGGGGACTCTGCGGCCCTGAAGCTCCGCGCAAGCGGCGCTCGCA

Click for details-----ITS1

TCACCGGCGGCGGGAGGGGGGGCGCGTCCGCAACGGGCGCTCCTCCTTCCCGCCCCACGCCGCGGGGAGAGGGACTCGTCCCGCTCCTGGCTGGCAAAACAACGAACCCCCGGCGCGGACTGCGCCAAGGAAATCTAACGAGAGAGCACGCTCCCGCGGCCCCGGAGAGGGGGCGGGTGCGGGGGTGCGGCGCCTTCTTTCACATGTATCCAAAA

Click for details-----ITS2

ATCGTTGCCCCACCCCACCCCCCCAAACCAAGGCGGGGGCCCCGGGGTGCGGGCGGAGATTGGCCTCCCGTGCGCTGACCGCTYGCGGTTGGCCCAAATWTGAGTCCTCGGCGACCGAAGCCGCGGCGATCGGTGGTGAAACAAAAGCCTCTCGAGCTCCCGCCGCGCGCCCGGTCTCCAAGTGGGGACTCTGCGGCCCTGAAGCTCCGCGCAAGCGGCGCTCGCA
Taxonomic Information

Plant ID: NPO5386
Plant Latin Name: Citrus X Paradisi
Taxonomy Genus: Citrus
Taxonomy Family: Rutaceae

Plant External Links:

NCBI TaxonomyDB: 37656
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
India

Traditional Medicine System:
Indian Folk

Geographical Distribution

India

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

162 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


101 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

95 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99088

Ingredient ID: NPC97515

Ingredient ID: NPC97285

Ingredient ID: NPC96388

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC89180

Ingredient ID: NPC88566

Ingredient ID: NPC86058

Ingredient ID: NPC85813

Ingredient ID: NPC85488

Ingredient ID: NPC84807

Ingredient ID: NPC81010

Ingredient ID: NPC79943

Ingredient ID: NPC79056

Ingredient ID: NPC79011

Ingredient ID: NPC76145

Ingredient ID: NPC74539

Ingredient ID: NPC73840

Ingredient ID: NPC7089

Ingredient ID: NPC70744

Ingredient ID: NPC70261

Ingredient ID: NPC70206

Ingredient ID: NPC68779

Ingredient ID: NPC65003

Ingredient ID: NPC62045

Ingredient ID: NPC60151

Ingredient ID: NPC59650

Ingredient ID: NPC55412

Ingredient ID: NPC53403

Ingredient ID: NPC49151

Ingredient ID: NPC491218

Ingredient ID: NPC490458

Ingredient ID: NPC490449

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC490311

Ingredient ID: NPC490163

Ingredient ID: NPC490162

Ingredient ID: NPC490159

Ingredient ID: NPC490157

Ingredient ID: NPC489907

Ingredient ID: NPC4817

Ingredient ID: NPC44830

Ingredient ID: NPC43587

Ingredient ID: NPC424

Ingredient ID: NPC41180

Ingredient ID: NPC39426

Ingredient ID: NPC37466

Ingredient ID: NPC328447

Ingredient ID: NPC32441

Ingredient ID: NPC317120

Ingredient ID: NPC315877

Ingredient ID: NPC313955

Ingredient ID: NPC304760

Ingredient ID: NPC302950

Ingredient ID: NPC302556

Ingredient ID: NPC302439

Ingredient ID: NPC300326

Ingredient ID: NPC29883

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC294200

Ingredient ID: NPC291124

Ingredient ID: NPC290319

Ingredient ID: NPC289668

Ingredient ID: NPC289388

Ingredient ID: NPC287397

Ingredient ID: NPC285173

Ingredient ID: NPC284311

Ingredient ID: NPC281686

Ingredient ID: NPC279865

Ingredient ID: NPC279121

Ingredient ID: NPC272614

Ingredient ID: NPC271270

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC26600

Ingredient ID: NPC2660

Ingredient ID: NPC265305

Ingredient ID: NPC259659

Ingredient ID: NPC258314

Ingredient ID: NPC257582

Ingredient ID: NPC255221

Ingredient ID: NPC254509

Ingredient ID: NPC243728

Ingredient ID: NPC242580

Ingredient ID: NPC237812

Ingredient ID: NPC237155

Ingredient ID: NPC236602

Ingredient ID: NPC231507

Ingredient ID: NPC230786

Ingredient ID: NPC230573

Ingredient ID: NPC229851

Ingredient ID: NPC228346

Ingredient ID: NPC226453

Ingredient ID: NPC226027

Ingredient ID: NPC225710

Ingredient ID: NPC221491

Ingredient ID: NPC22140

Ingredient ID: NPC22098

Ingredient ID: NPC219143

Ingredient ID: NPC218109

Ingredient ID: NPC216630

Ingredient ID: NPC213876

Ingredient ID: NPC21380

Ingredient ID: NPC211442

Ingredient ID: NPC210831

Ingredient ID: NPC208793

Ingredient ID: NPC20791

Ingredient ID: NPC203468

Ingredient ID: NPC201844

Ingredient ID: NPC201284

Ingredient ID: NPC199072

Ingredient ID: NPC198658

Ingredient ID: NPC190771

Ingredient ID: NPC190270

Ingredient ID: NPC189436

Ingredient ID: NPC187770

Ingredient ID: NPC185755

Ingredient ID: NPC182840

Ingredient ID: NPC182385

Ingredient ID: NPC18205

Ingredient ID: NPC178158

Ingredient ID: NPC17810

Ingredient ID: NPC177771

Ingredient ID: NPC177365

Ingredient ID: NPC17695

Ingredient ID: NPC175122

Ingredient ID: NPC174246

Ingredient ID: NPC169749

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC164487

Ingredient ID: NPC15912

Ingredient ID: NPC158088

Ingredient ID: NPC157192

Ingredient ID: NPC156654

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC147983

Ingredient ID: NPC142860

Ingredient ID: NPC141078

Ingredient ID: NPC13991

Ingredient ID: NPC138572

Ingredient ID: NPC137958

Ingredient ID: NPC13789

Ingredient ID: NPC136014

Ingredient ID: NPC135353

Ingredient ID: NPC131482

Ingredient ID: NPC130760

Ingredient ID: NPC130683

Ingredient ID: NPC126681

Ingredient ID: NPC123965

Ingredient ID: NPC122962

Ingredient ID: NPC116775

Ingredient ID: NPC11433

Ingredient ID: NPC112890

Ingredient ID: NPC111888

Ingredient ID: NPC110008

Ingredient ID: NPC105095

Ingredient ID: NPC100551