• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Castanea Crenata


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GGAAGGATCATTGTCGAGACCTGCGAGGCAGACCGCGAACACGTGTTTGATCAAAACTTTGCGCCGGTCGCCGCGGGGAGGCGGGGGCTCGTCCCTCCCGCTCCGTCGGCCCCGGCGCCCGCGCGGCGCGCCCTCGAGCGCGTCGGGCGGGCTAACGAACTCCCGGCGCGGAACGCGCCAAGGAAAACCGAAAACGAAGCGCCCCGTCCGGCCCCCAACCGCCCAGCACGGGTGCGCGGGGGGKGGGCGGGTCGCCTCGACCTCATAAGATGATGATGATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCNNNNNNNANAANNNNANANAATCCGTGACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCCTCCCTCCGGGGCGGGGGGCGGACATTGGCCTCCCGTGCGCTCCCGCGCGCGGCCGGCCCAAATGGGATCCCCCGGCGACGCGCGCCGCGACCAGTGGTGGTYGGTTGAACAACGCTCAGCTCCCTTGCTGTCCGTCGCGCCCCGCGCCGTCGTCCGGACGGGCATCACGAACGACCCCGAGCGCGCCCCCCGGGCGCCTCCGACCGCGACCCCAGGTCAGGSGGGATCACCCG

Click for details-----ITS1

GGAAGGATCATTGTCGAGACCTGCGAGGCAGACCGCGAACACGTGTTTGATCAAAACTTTGCGCCGGTCGCCGCGGGGAGGCGGGGGCTCGTCCCTCCCGCTCCGTCGGCCCCGGCGCCCGCGCGGCGCGCCCTCGAGCGCGTCGGGCGGGCTAACGAACTCCCGGCGCGGAACGCGCCAAGGAAAACCGAAAACGAAGCGCCCCGTCCGGCCCCCAACCGCCCAGCACGGGTGCGCGGGGGGKGGGCGGGTCGCCTCGACCTCATAAGATGATGATGATGTCAAAA

Click for details-----ITS2

GCCCATCCACGCTCGGTTGCCTTGCCATCACGAGTGCTTGGCCCGATGCGGACATTGGCCCTCCGAACCGCGAGGCGCGGTGGGCCCAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGCTACTGCGCACGCCACCCCGAGCCCCATGCCGACAGAGGGCCCTGTTCGACCCCCTAACGAGGAGCATGCCGCCGCGGCTCCATGCTGTGCGGCATCTTCGGACC
Taxonomic Information

Plant ID: NPO5303
Plant Latin Name: Castanea Crenata
Taxonomy Genus: Castanea
Taxonomy Family: Fagaceae

Plant External Links:

NCBI TaxonomyDB: 103480
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
South Korea

Traditional Medicine System:

Geographical Distribution

South Korea

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

179 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


53 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

60 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC96558

Ingredient ID: NPC94509

Ingredient ID: NPC93220

Ingredient ID: NPC92169

Ingredient ID: NPC91693

Ingredient ID: NPC9000

Ingredient ID: NPC89929

Ingredient ID: NPC88101

Ingredient ID: NPC8694

Ingredient ID: NPC85813

Ingredient ID: NPC82884

Ingredient ID: NPC80507

Ingredient ID: NPC78992

Ingredient ID: NPC75789

Ingredient ID: NPC73479

Ingredient ID: NPC71171

Ingredient ID: NPC68184

Ingredient ID: NPC67251

Ingredient ID: NPC65870

Ingredient ID: NPC61893

Ingredient ID: NPC61771

Ingredient ID: NPC61694

Ingredient ID: NPC596

Ingredient ID: NPC54950

Ingredient ID: NPC54105

Ingredient ID: NPC51888

Ingredient ID: NPC48236

Ingredient ID: NPC47815

Ingredient ID: NPC45659

Ingredient ID: NPC45218

Ingredient ID: NPC430

Ingredient ID: NPC41527

Ingredient ID: NPC37685

Ingredient ID: NPC35777

Ingredient ID: NPC34710

Ingredient ID: NPC32534

Ingredient ID: NPC32298

Ingredient ID: NPC312833

Ingredient ID: NPC309096

Ingredient ID: NPC307050

Ingredient ID: NPC30678

Ingredient ID: NPC305987

Ingredient ID: NPC305315

Ingredient ID: NPC302406

Ingredient ID: NPC301920

Ingredient ID: NPC299849

Ingredient ID: NPC29620

Ingredient ID: NPC294919

Ingredient ID: NPC293487

Ingredient ID: NPC288855

Ingredient ID: NPC287343

Ingredient ID: NPC283170

Ingredient ID: NPC281693

Ingredient ID: NPC280907

Ingredient ID: NPC280052

Ingredient ID: NPC279121

Ingredient ID: NPC278866

Ingredient ID: NPC277597

Ingredient ID: NPC276886

Ingredient ID: NPC275681

Ingredient ID: NPC265557

Ingredient ID: NPC261831

Ingredient ID: NPC258973

Ingredient ID: NPC255352

Ingredient ID: NPC254892

Ingredient ID: NPC25101

Ingredient ID: NPC247792

Ingredient ID: NPC24770

Ingredient ID: NPC246664

Ingredient ID: NPC24651

Ingredient ID: NPC244706

Ingredient ID: NPC243981

Ingredient ID: NPC242332

Ingredient ID: NPC241693

Ingredient ID: NPC241365

Ingredient ID: NPC241192

Ingredient ID: NPC2405

Ingredient ID: NPC234029

Ingredient ID: NPC229469

Ingredient ID: NPC228346

Ingredient ID: NPC227438

Ingredient ID: NPC225630

Ingredient ID: NPC225297

Ingredient ID: NPC22377

Ingredient ID: NPC223463

Ingredient ID: NPC220137

Ingredient ID: NPC219913

Ingredient ID: NPC219751

Ingredient ID: NPC219063

Ingredient ID: NPC217011

Ingredient ID: NPC216060

Ingredient ID: NPC2147

Ingredient ID: NPC214610

Ingredient ID: NPC213862

Ingredient ID: NPC213084

Ingredient ID: NPC212213

Ingredient ID: NPC212150

Ingredient ID: NPC210727

Ingredient ID: NPC209970

Ingredient ID: NPC209936

Ingredient ID: NPC20665

Ingredient ID: NPC205955

Ingredient ID: NPC204731

Ingredient ID: NPC204510

Ingredient ID: NPC203719

Ingredient ID: NPC202945

Ingredient ID: NPC201562

Ingredient ID: NPC200836

Ingredient ID: NPC200741

Ingredient ID: NPC199414

Ingredient ID: NPC197944

Ingredient ID: NPC194071

Ingredient ID: NPC194040

Ingredient ID: NPC194017

Ingredient ID: NPC193087

Ingredient ID: NPC190185

Ingredient ID: NPC190094

Ingredient ID: NPC190065

Ingredient ID: NPC189142

Ingredient ID: NPC187039

Ingredient ID: NPC184224

Ingredient ID: NPC182181

Ingredient ID: NPC181683

Ingredient ID: NPC179393

Ingredient ID: NPC176513

Ingredient ID: NPC174672

Ingredient ID: NPC173686

Ingredient ID: NPC173386

Ingredient ID: NPC171955

Ingredient ID: NPC171432

Ingredient ID: NPC171316

Ingredient ID: NPC170997

Ingredient ID: NPC170129

Ingredient ID: NPC169149

Ingredient ID: NPC168475

Ingredient ID: NPC167767

Ingredient ID: NPC165964

Ingredient ID: NPC165317

Ingredient ID: NPC165050

Ingredient ID: NPC164575

Ingredient ID: NPC163908

Ingredient ID: NPC16378

Ingredient ID: NPC161557

Ingredient ID: NPC16081

Ingredient ID: NPC160116

Ingredient ID: NPC156971

Ingredient ID: NPC154165

Ingredient ID: NPC153658

Ingredient ID: NPC153072

Ingredient ID: NPC152301

Ingredient ID: NPC15167

Ingredient ID: NPC149644

Ingredient ID: NPC146432

Ingredient ID: NPC143268

Ingredient ID: NPC141700

Ingredient ID: NPC141215

Ingredient ID: NPC140604

Ingredient ID: NPC140045

Ingredient ID: NPC137806

Ingredient ID: NPC131048

Ingredient ID: NPC130413

Ingredient ID: NPC128442

Ingredient ID: NPC12649

Ingredient ID: NPC126409

Ingredient ID: NPC122611

Ingredient ID: NPC122033

Ingredient ID: NPC120872

Ingredient ID: NPC120736

Ingredient ID: NPC120426

Ingredient ID: NPC117322

Ingredient ID: NPC115334

Ingredient ID: NPC114973

Ingredient ID: NPC114019

Ingredient ID: NPC113727

Ingredient ID: NPC105734

Ingredient ID: NPC105534

Ingredient ID: NPC103349

Ingredient ID: NPC102527

Ingredient ID: NPC102465