• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Myristica Fragrans


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CGAATTCCCCCCAATGCCCGATGAGAGACCCCCTTTTTGGGGTGTCTCGGCCTCACCCCCTCTTTTTTTTTCCCGCCCAACCCTTTAAAAAAACAAACAGGGGGGGAACCCCTTTCTCCCTTCTCGCCGCCCCAAAAAAAATAAACCTCTTCTCCAGAAAGGAGGGGGGGGAAAACCCCCGGCCGACAAACCGTTTTCTCCCGGGGGCTGCCCAATATTGTTTCAAAGTTTGGGGTCCGGGGATTTTTCCAATCCCCACTTGTTTTTCCGTTTGCGGGCTTTTTAAATGTTAAAAACACAAATTTTTGTTTTTAATTTTTCTTTTTAAAACTTCCCCAATAAAACCCATTAAAGCTTTCGAGTTTGTTTTCCCTTGTTAACCTTGGGTTAAAGCTTCCAAAGGGAAATTAATGAATGATTACTTCTGTAGGTGATGGTGAGGAAGATTCATTAAGAAAAATAGTTTTAAGGAGGAAAAGGTAAGCTTCCATTAAAGGTACCTGGGGAAGGATCAGTGCATGNATNANTAGTCCTTTCCCTGAAGGGGACTGCGGAAGGATCATTGAATTATTAAAACCACAATGTGAACCTTATTGTTCCGTGCCTTTGCTGCCAGCAAGGCAATCAGCTTTGCCTGATTGTACTTGCAAGCTGGTGCGAGTTTTATACTTGCATCAGTGGCGCTCTGGCATGCTTATACACCAGTGCTAACCACTGTCAAAACCAAACTCTGAAGCTTTGATTGCTATTAATTGGCAATCTTAACCAAAGACAACTCTCAACAACGGATATCTTGGCTCTCGCAACGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCCGTGAACCATCGAATCTTTGAACGCATATTGCGCTCGAGCCCTCGGGCAAGAGCATGTCTGCCTCAGCGTCGGTTTATACCCTCACCCCTCTCTCCTTTGGGAGAGTCTGGTTAGCTTCTTGCTGGCCTTAGGAGTGGATCTGGCTTTCCCATTTGGTTTATTCTGAATGGGTTGGCTGAAGCTTAGAGGCTTAAGCAAGGACCCAATATGGGCTTCAACTGGATAGGTAGCACCGGCTTCTGCCGACTACACGAAGTTGTGGCTTGTGGACTTTGCTAGAGGCC

Click for details-----ITS1

AAGGATCATTGACATGCCTTAAAGGCAAACAACCTGCGAACTTGTTTATAAATCCGTGGCATCGTTGCGTGCTGGTGCTTGCCTCTCAAGTCAGTCACGTTGGTTGCATCACAAGCATGCCGTTTCTTGCTCGCGAGGGCTCGATGGTTGTGCTTTTGTTGTGCTGGCGTGAGCCCAATTGGGTGCGTTGGTTCCGCTTATGGCGTGCTTGCGCTTGCTCAATTGGGCACGTTGGTTCCGCTTTAAGGCGTGCTCGCGTTTGGTTCAAGCCTATGAAGGTTCCGCTGTTGGGTGTGCTTGCGTTTGGTTCAGGCCAACGTTGGTTCCGCTCCTAGGCGTGCTTGCATATGGTTTTGAGCCTACGCTGGTTCCGCACTTAGGCGTGCTTGCGTCTGGCTCAAGCCTACGTTTGTTCCGCTCTCATGCGTGCTTGCGCTCGCTCAACTGGGCACGTAGGTTCTGCTTTGAGGCGTGCTTGCGTCAGGTTTAGGCCTACGTTCGTTCCGCTCTTGAGCGTGCTTCCGCTTGATCTTGAGTGCCGTCAGTTCCGCAACGATGCTGCACCCCCCGATGCACTGGGCTTGCTCGGTGTAGCGGGCTAACCAACCCCCGGCACGAGTTGTGCCAAGGAACACAAAAACATACGATAGGGGTGCTCCATCCCTAGAGTAGAAAACAAAA

Click for details-----ITS2

TCCACCCTCTCGCCCCTCTCACCACATCATCATCCCTTGCGCGGATGGTGGCGGGTGAGTCTGGTCGACCGCTCTCGGTCGGCCTCAGGGGCGGATCTGGCCTCCCCAATCGATCGATCCGATCGCTTGGGTTGGCTGAAGCGCAGAGGCTTAACCACGGACCCGAATGGGCTTCAACTGGATAGGTAGCGCCGGCTCTTTCTCTCTTCTGTTCCTCTCTCGCGAGAGGAGGAGAGGGAGGAGGGTCGTCTACACGAAGTTGTGGCCTGTGGACCTTGGTAGGGGCCAAGCAGGAAACGATCGTGCGCTCCGACTGCGTCTGTTCCGACTCTCTCTCGCATCTCGAGCGAGCGCAGAGGAGAGACAGACACACACGGGGGCGCGCGCACGTCCGACAC
Taxonomic Information

Plant ID: NPO5241
Plant Latin Name: Myristica Fragrans
Taxonomy Genus: Myristica
Taxonomy Family: Myristicaceae

Plant External Links:

NCBI TaxonomyDB: 51089
Plant-of-the-World-Online: 586076-1

Used in Medicines

Country/Region:
Brazil; Afghanistan; Yemen; Mexico; Lebanon; Indonesia; India; United States; Malaysia; Jordan; Germany; China; Sri Lanka; Thailand; Iraq

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; TCM; Homeopathy

Geographical Distribution

Brazil; Afghanistan; Yemen; United States; Bangladesh; Mexico; Lebanon; Philippines; Indonesia; India; Jordan; Malaysia; Germany; Thailand; Sri Lanka; China; Taiwan; Iraq; Mauritius

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

305 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


272 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

154 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99734

Ingredient ID: NPC99638

Ingredient ID: NPC9880

Ingredient ID: NPC95675

Ingredient ID: NPC95231

Ingredient ID: NPC94167

Ingredient ID: NPC93843

Ingredient ID: NPC93336

Ingredient ID: NPC92197

Ingredient ID: NPC92114

Ingredient ID: NPC91702

Ingredient ID: NPC90083

Ingredient ID: NPC88566

Ingredient ID: NPC87828

Ingredient ID: NPC85813

Ingredient ID: NPC85045

Ingredient ID: NPC81781

Ingredient ID: NPC81010

Ingredient ID: NPC80500

Ingredient ID: NPC80241

Ingredient ID: NPC78551

Ingredient ID: NPC76145

Ingredient ID: NPC71703

Ingredient ID: NPC71553

Ingredient ID: NPC71506

Ingredient ID: NPC70744

Ingredient ID: NPC68889

Ingredient ID: NPC67986

Ingredient ID: NPC67788

Ingredient ID: NPC67012

Ingredient ID: NPC66819

Ingredient ID: NPC66436

Ingredient ID: NPC66292

Ingredient ID: NPC6520

Ingredient ID: NPC64357

Ingredient ID: NPC64176

Ingredient ID: NPC63238

Ingredient ID: NPC62086

Ingredient ID: NPC61769

Ingredient ID: NPC61477

Ingredient ID: NPC60556

Ingredient ID: NPC57119

Ingredient ID: NPC56214

Ingredient ID: NPC55586

Ingredient ID: NPC55412

Ingredient ID: NPC55349

Ingredient ID: NPC5437

Ingredient ID: NPC51700

Ingredient ID: NPC50408

Ingredient ID: NPC49603

Ingredient ID: NPC489907

Ingredient ID: NPC48638

Ingredient ID: NPC48623

Ingredient ID: NPC484135

Ingredient ID: NPC484134

Ingredient ID: NPC484133

Ingredient ID: NPC475018

Ingredient ID: NPC475017

Ingredient ID: NPC475009

Ingredient ID: NPC475008

Ingredient ID: NPC474839

Ingredient ID: NPC471505

Ingredient ID: NPC45727

Ingredient ID: NPC45540

Ingredient ID: NPC44751

Ingredient ID: NPC424

Ingredient ID: NPC41594

Ingredient ID: NPC37947

Ingredient ID: NPC37644

Ingredient ID: NPC3649

Ingredient ID: NPC36108

Ingredient ID: NPC35437

Ingredient ID: NPC354196

Ingredient ID: NPC34764

Ingredient ID: NPC33675

Ingredient ID: NPC328912

Ingredient ID: NPC324138

Ingredient ID: NPC322552

Ingredient ID: NPC322400

Ingredient ID: NPC320881

Ingredient ID: NPC320287

Ingredient ID: NPC318591

Ingredient ID: NPC3155

Ingredient ID: NPC31279

Ingredient ID: NPC312713

Ingredient ID: NPC310905

Ingredient ID: NPC310208

Ingredient ID: NPC309182

Ingredient ID: NPC309053

Ingredient ID: NPC308841

Ingredient ID: NPC307123

Ingredient ID: NPC30668

Ingredient ID: NPC303153

Ingredient ID: NPC301585

Ingredient ID: NPC301583

Ingredient ID: NPC301043

Ingredient ID: NPC29976

Ingredient ID: NPC296337

Ingredient ID: NPC295998

Ingredient ID: NPC295644

Ingredient ID: NPC294902

Ingredient ID: NPC292792

Ingredient ID: NPC290971

Ingredient ID: NPC29008

Ingredient ID: NPC288537

Ingredient ID: NPC287926

Ingredient ID: NPC287660

Ingredient ID: NPC287331

Ingredient ID: NPC28681

Ingredient ID: NPC284135

Ingredient ID: NPC283408

Ingredient ID: NPC282703

Ingredient ID: NPC282305

Ingredient ID: NPC277700

Ingredient ID: NPC277184

Ingredient ID: NPC276009

Ingredient ID: NPC275152

Ingredient ID: NPC274356

Ingredient ID: NPC270989

Ingredient ID: NPC269919

Ingredient ID: NPC26906

Ingredient ID: NPC268862

Ingredient ID: NPC268377

Ingredient ID: NPC267990

Ingredient ID: NPC267210

Ingredient ID: NPC2660

Ingredient ID: NPC264711

Ingredient ID: NPC261831

Ingredient ID: NPC261661

Ingredient ID: NPC261104

Ingredient ID: NPC257872

Ingredient ID: NPC257124

Ingredient ID: NPC256098

Ingredient ID: NPC255662

Ingredient ID: NPC255577

Ingredient ID: NPC252552

Ingredient ID: NPC251040

Ingredient ID: NPC249965

Ingredient ID: NPC24824

Ingredient ID: NPC24815

Ingredient ID: NPC246165

Ingredient ID: NPC245076

Ingredient ID: NPC244441

Ingredient ID: NPC243749

Ingredient ID: NPC243259

Ingredient ID: NPC242580

Ingredient ID: NPC241784

Ingredient ID: NPC240308

Ingredient ID: NPC239039

Ingredient ID: NPC238737

Ingredient ID: NPC237254

Ingredient ID: NPC236579

Ingredient ID: NPC236215

Ingredient ID: NPC235901

Ingredient ID: NPC233731

Ingredient ID: NPC232375

Ingredient ID: NPC232316

Ingredient ID: NPC231738

Ingredient ID: NPC230828

Ingredient ID: NPC229607

Ingredient ID: NPC229383

Ingredient ID: NPC228799

Ingredient ID: NPC227670

Ingredient ID: NPC227378

Ingredient ID: NPC227217

Ingredient ID: NPC227002

Ingredient ID: NPC225840

Ingredient ID: NPC222986

Ingredient ID: NPC22229

Ingredient ID: NPC222001

Ingredient ID: NPC221733

Ingredient ID: NPC22098

Ingredient ID: NPC219876

Ingredient ID: NPC219671

Ingredient ID: NPC21867

Ingredient ID: NPC218197

Ingredient ID: NPC216630

Ingredient ID: NPC216394

Ingredient ID: NPC215975

Ingredient ID: NPC215911

Ingredient ID: NPC215894

Ingredient ID: NPC215632

Ingredient ID: NPC21563

Ingredient ID: NPC214584

Ingredient ID: NPC213749

Ingredient ID: NPC21266

Ingredient ID: NPC212015

Ingredient ID: NPC211774

Ingredient ID: NPC210969

Ingredient ID: NPC210674

Ingredient ID: NPC210560

Ingredient ID: NPC210489

Ingredient ID: NPC209970

Ingredient ID: NPC209275

Ingredient ID: NPC20791

Ingredient ID: NPC207561

Ingredient ID: NPC20674

Ingredient ID: NPC205643

Ingredient ID: NPC204120

Ingredient ID: NPC203924

Ingredient ID: NPC20387

Ingredient ID: NPC203831

Ingredient ID: NPC201844

Ingredient ID: NPC198658

Ingredient ID: NPC197318

Ingredient ID: NPC196976

Ingredient ID: NPC194996

Ingredient ID: NPC19319

Ingredient ID: NPC193026

Ingredient ID: NPC192961

Ingredient ID: NPC192538

Ingredient ID: NPC190810

Ingredient ID: NPC190629

Ingredient ID: NPC189436

Ingredient ID: NPC188238

Ingredient ID: NPC187770

Ingredient ID: NPC187616

Ingredient ID: NPC186556

Ingredient ID: NPC186097

Ingredient ID: NPC184733

Ingredient ID: NPC183987

Ingredient ID: NPC181869

Ingredient ID: NPC181153

Ingredient ID: NPC180871

Ingredient ID: NPC178284

Ingredient ID: NPC17810

Ingredient ID: NPC177112

Ingredient ID: NPC175987

Ingredient ID: NPC174727

Ingredient ID: NPC173996

Ingredient ID: NPC17240

Ingredient ID: NPC170779

Ingredient ID: NPC167400

Ingredient ID: NPC166894

Ingredient ID: NPC166553

Ingredient ID: NPC166362

Ingredient ID: NPC166348

Ingredient ID: NPC165651

Ingredient ID: NPC164487

Ingredient ID: NPC16272

Ingredient ID: NPC161405

Ingredient ID: NPC159805

Ingredient ID: NPC15912

Ingredient ID: NPC156654

Ingredient ID: NPC15658

Ingredient ID: NPC155338

Ingredient ID: NPC154685

Ingredient ID: NPC154480

Ingredient ID: NPC154258

Ingredient ID: NPC150950

Ingredient ID: NPC150713

Ingredient ID: NPC150643

Ingredient ID: NPC14930

Ingredient ID: NPC147983

Ingredient ID: NPC146197

Ingredient ID: NPC144561

Ingredient ID: NPC144023

Ingredient ID: NPC142415

Ingredient ID: NPC141777

Ingredient ID: NPC141699

Ingredient ID: NPC141529

Ingredient ID: NPC13991

Ingredient ID: NPC139546

Ingredient ID: NPC138113

Ingredient ID: NPC136434

Ingredient ID: NPC136014

Ingredient ID: NPC135479

Ingredient ID: NPC131431

Ingredient ID: NPC130683

Ingredient ID: NPC129570

Ingredient ID: NPC128208

Ingredient ID: NPC128061

Ingredient ID: NPC127326

Ingredient ID: NPC127233

Ingredient ID: NPC126240

Ingredient ID: NPC125062

Ingredient ID: NPC124042

Ingredient ID: NPC12362

Ingredient ID: NPC123526

Ingredient ID: NPC119949

Ingredient ID: NPC118561

Ingredient ID: NPC118288

Ingredient ID: NPC116775

Ingredient ID: NPC116130

Ingredient ID: NPC116003

Ingredient ID: NPC115663

Ingredient ID: NPC114239

Ingredient ID: NPC112866

Ingredient ID: NPC112237

Ingredient ID: NPC110899

Ingredient ID: NPC110729

Ingredient ID: NPC109813

Ingredient ID: NPC1075

Ingredient ID: NPC106739

Ingredient ID: NPC106221

Ingredient ID: NPC105513

Ingredient ID: NPC105209

Ingredient ID: NPC104934

Ingredient ID: NPC104895

Ingredient ID: NPC104308

Ingredient ID: NPC10251

Ingredient ID: NPC102091

Ingredient ID: NPC101153

Ingredient ID: NPC100551

Ingredient ID: NPC100362