• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Euphorbia Lathyris


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCACAGCAGAACGACCCGCGAACGCGTTCCCAGAACGGGGGGGTCGGTGCTCCGGCATCCGCCCCCCAACCGGGGCCCCGGGCGCGGGATACGGGTGCGGGCTCTCCGCCGCGCCCCCGCATCCTCCGTCCGAGGCCTCCTAACAAAACCCCGGCGCAGGACGCGCCAAGGAATCGAAAACGGAAAGGACGCACGCTCCGCGCGTCCCGGAAACGGTGAGCGCGCGGAACGCGTGGCGCGCTTTTAGAACCAGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCCGGCCGAGGGCACGCCTGCCTGGGTGTCACTCAATCGTCGCCCCAGCCGCCTCCCGCGAGGGGGGCGCGCTCGGGGCGGATGCTGGCTTCCCGCGCGCTCGCAGCCCGCGGCTGGCCCAAATGCCCGGTCCTCGGCGGTCGCGCCACGGCAGTCGGTGGTTGCAAGACCCTCGCCAGTCGCCGTGCGCGCTCGGCCGTCCGTGCGGACCCACGAGACCCCGAAGCGTCACCCGAGGGTGCGCTCGCTCTGCGACC

Click for details-----ITS1

TCGAAACCTGCACAGCAGAACGACCCGCGAACGCGTTCCCAGAACGGGGGGGTCGGTGCTCCGGCATCCGCCCCCCAACCGGGGCCCCGGGCGCGGGATACGGGTGCGGGCTCTCCGCCGCGCCCCCGCATCCTCCGTCCGAGGCCTCCTAACAAAACCCCGGCGCAGGACGCGCCAAGGAATCGAAAACGGAAAGGACGCACGCTCCGCGCGTCCCGGAAACGGTGAGCGCGCGGAACGCGTGGCGCGCTTTTAGAACCAGAA

Click for details-----ITS2

CAATCGTCGCCCCAGCCGCCTCCCGCGAGGGGGGCGCGCTCGGGGCGGATGCTGGCTTCCCGCGCGCTCGCAGCCCGCGGCTGGCCCAAATGCCCGGTCCTCGGCGGTCGCGCCACGGCAGTCGGTGGTTGCAAGACCCTCGCCAGTCGCCGTGCGCGCTCGGCCGTCCGTGCGGACCCACGAGACCCCGAAGCGTCACCCGAGGGTGCGCTCGCTCTGCGACC
Taxonomic Information

Plant ID: NPO520
Plant Latin Name: Euphorbia Lathyris
Taxonomy Genus: Euphorbia
Taxonomy Family: Euphorbiaceae

Plant External Links:

NCBI TaxonomyDB: 212925
Plant-of-the-World-Online: 347072-1

Used in Medicines

Country/Region:
China; Italy; India

Traditional Medicine System:
Indian Folk; TCM; Unani


Medicinal Functions:

Abortifacient; Antiseptic; Cancer; Diuretic; Emetic; Purgative; Warts

Geographical Distribution

Brazil; Italy; France; Ethiopia; Argentina; Bolivia; Venezuela; China; Chile; Belgium; Germany; Spain; United States; Morocco; Vietnam; New Zealand; Russia; Pakistan; Albania; Portugal; Mexico; Uruguay; India; United Kingdom

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

97 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


31 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

38 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99794

Ingredient ID: NPC95615

Ingredient ID: NPC92898

Ingredient ID: NPC8990

Ingredient ID: NPC85482

Ingredient ID: NPC78542

Ingredient ID: NPC76859

Ingredient ID: NPC74150

Ingredient ID: NPC73738

Ingredient ID: NPC70361

Ingredient ID: NPC59326

Ingredient ID: NPC53475

Ingredient ID: NPC50209

Ingredient ID: NPC482356

Ingredient ID: NPC482355

Ingredient ID: NPC482354

Ingredient ID: NPC482353

Ingredient ID: NPC482352

Ingredient ID: NPC482351

Ingredient ID: NPC482350

Ingredient ID: NPC482349

Ingredient ID: NPC482348

Ingredient ID: NPC482347

Ingredient ID: NPC482346

Ingredient ID: NPC482345

Ingredient ID: NPC482343

Ingredient ID: NPC477356

Ingredient ID: NPC46160

Ingredient ID: NPC44382

Ingredient ID: NPC42234

Ingredient ID: NPC39809

Ingredient ID: NPC3450

Ingredient ID: NPC34057

Ingredient ID: NPC331613

Ingredient ID: NPC318731

Ingredient ID: NPC3185

Ingredient ID: NPC317480

Ingredient ID: NPC314120

Ingredient ID: NPC313334

Ingredient ID: NPC308191

Ingredient ID: NPC306310

Ingredient ID: NPC292701

Ingredient ID: NPC282285

Ingredient ID: NPC281452

Ingredient ID: NPC276652

Ingredient ID: NPC272087

Ingredient ID: NPC27154

Ingredient ID: NPC270364

Ingredient ID: NPC264653

Ingredient ID: NPC26229

Ingredient ID: NPC261341

Ingredient ID: NPC259168

Ingredient ID: NPC252593

Ingredient ID: NPC24873

Ingredient ID: NPC247553

Ingredient ID: NPC24580

Ingredient ID: NPC243595

Ingredient ID: NPC242861

Ingredient ID: NPC24233

Ingredient ID: NPC240818

Ingredient ID: NPC239568

Ingredient ID: NPC23322

Ingredient ID: NPC230301

Ingredient ID: NPC226958

Ingredient ID: NPC219699

Ingredient ID: NPC219333

Ingredient ID: NPC216541

Ingredient ID: NPC215626

Ingredient ID: NPC212755

Ingredient ID: NPC212670

Ingredient ID: NPC206438

Ingredient ID: NPC206264

Ingredient ID: NPC202964

Ingredient ID: NPC186653

Ingredient ID: NPC177825

Ingredient ID: NPC161593

Ingredient ID: NPC159737

Ingredient ID: NPC159362

Ingredient ID: NPC156358

Ingredient ID: NPC151859

Ingredient ID: NPC145218

Ingredient ID: NPC143569

Ingredient ID: NPC143073

Ingredient ID: NPC139891

Ingredient ID: NPC137949

Ingredient ID: NPC127302

Ingredient ID: NPC126395

Ingredient ID: NPC122504

Ingredient ID: NPC11977

Ingredient ID: NPC118799

Ingredient ID: NPC118405

Ingredient ID: NPC11666

Ingredient ID: NPC113272

Ingredient ID: NPC112971

Ingredient ID: NPC106253

Ingredient ID: NPC105222

Ingredient ID: NPC101738