• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Diplospora Dubia


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGCGTAGCAGACGACCGCGAACTCGTGTAACCGTCGGGCGTCGGGGGACGGGCGGCGAGGCCGAACCCTCCCGTCCTTCCCCCTCGCTCCCCGCGCGCTCGTCGCGCGGACCAACAACCCAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAGAGATCGCCCGGCCCCCGACCGCCCCGTCCGCGGAGCGCGGGAGGGGATGCCGCGGCGTCCGTCGTAACCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCSSKYSSCCMCCCCCCTCTTGCGGGGCGGCGGAGACTGGCCTCCCGTGCCCCCCGGGCGCGGCCGGCCTAAATGCGAGTCCTCGGCGAGGGACGTCACGACTAGTGGTGGTTGAATCCCTCAACTCGATTCCTTGTCGTGCCGGCGACCCCCGCCGCAGTTCGGCCTCCCACGACCCTCAAGCTCGCGCTTCGGCTCGAGCCTCGACCGCGACCCCAGGTCA

Click for details-----ITS1

TCGAATCCTGCGTAGCAGACGACCGCGAACTCGTGTAACCGTCGGGCGTCGGGGGACGGGCGGCGAGGCCGAACCCTCCCGTCCTTCCCCCTCGCTCCCCGCGCGCTCGTCGCGCGGACCAACAACCCAAACCCCGGCGCGGAAAGCGCCAAGGAAAACTCAAAGAGATCGCCCGGCCCCCGACCGCCCCGTCCGCGGAGCGCGGGAGGGGATGCCGCGGCGTCCGTCGTAACCAAAA

Click for details-----ITS2

ATCSSKYSSCCMCCCCCCTCTTGCGGGGCGGCGGAGACTGGCCTCCCGTGCCCCCCGGGCGCGGCCGGCCTAAATGCGAGTCCTCGGCGAGGGACGTCACGACTAGTGGTGGTTGAATCCCTCAACTCGATTCCTTGTCGTGCCGGCGACCCCCGCCGCAGTTCGGCCTCCCACGACCCTCAAGCTCGCGCTTCGGCTCGAGCCTCGACCGCGACCCCAGGTCA
Taxonomic Information

Plant ID: NPO5175
Plant Latin Name: Diplospora Dubia
Taxonomy Genus: Diplospora
Taxonomy Family: Rubiaceae

Plant External Links:

NCBI TaxonomyDB: 339291
Plant-of-the-World-Online: 748497-1

Used in Medicines

Unknown.

Geographical Distribution

Taiwan; Vietnam; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

15 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


5 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

7 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC86906

Ingredient ID: NPC79238

Ingredient ID: NPC7214

Ingredient ID: NPC71621

Ingredient ID: NPC38216

Ingredient ID: NPC36783

Ingredient ID: NPC301585

Ingredient ID: NPC283277

Ingredient ID: NPC272592

Ingredient ID: NPC21664

Ingredient ID: NPC171175

Ingredient ID: NPC161162

Ingredient ID: NPC151843

Ingredient ID: NPC118329

Ingredient ID: NPC110615