• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Tsuga Diversifolia


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ACAATATACGCCCTCTTTGCACGGTAGCGGGGAGGAGCGGAAATGGCCGTCCGTGCCCAACGTGGTGCGGTTGGCTGAAATGCATTCGATGTTGTGCGCTTTGCATCGGCCAGCGGTGGCCTTGTCCCCCCTTTGGTTGGGGGCGAGTCGGCGTTTGCCCATGCGAGGTGTGCTCGACGTCGTATGAACTTTGTTTGGGCACTATC
Taxonomic Information

Plant ID: NPO5154
Plant Latin Name: Tsuga Diversifolia
Taxonomy Genus: Tsuga
Taxonomy Family: Pinaceae

Plant External Links:

NCBI TaxonomyDB: 85622
Plant-of-the-World-Online: 264007-1

Used in Medicines

Unknown.

Geographical Distribution

Japan; South Africa

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

17 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


11 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

9 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC94123

Ingredient ID: NPC91678

Ingredient ID: NPC50898

Ingredient ID: NPC49074

Ingredient ID: NPC299605

Ingredient ID: NPC279121

Ingredient ID: NPC269904

Ingredient ID: NPC265171

Ingredient ID: NPC224651

Ingredient ID: NPC18335

Ingredient ID: NPC179291

Ingredient ID: NPC178092

Ingredient ID: NPC156461

Ingredient ID: NPC133671

Ingredient ID: NPC121702

Ingredient ID: NPC111929

Ingredient ID: NPC10383