• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Alpinia Galanga


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TTGAGAGTGCATTGAATGATGGATGGTTGCGAATGTGTCAACGTGCCCCTTTCCTTGCCCCATGTTGCTGGGCAATTGATCGTAGCTCGGTGCGATCGGCACCAAGGAATAATAAACTGAGAAGCAAAGGGCCCTCGGTGTGTGCGGGGAGCCCAATGCGTCGGAGAAGCCTCGAAATCAAATGACTCTCGGCAATGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCTCGTGAATCATTGAGTCTTTGAACGCAAGTTGTGCCCGAGGCCTTGTGGCCGAGGGCACGCCTGCTTGGGCGTCATGGCATCGTCGCCTTTGCTCCTTGCTTTGCTGCTGGTGCTAAGTGCGGAAATTGGCCTCGTGTGCCCTCRGGCGAGGGCACAGTCGGTTGAAGAGTGGGTAGTCGGTAGACGTCGGGCRCGATGGGTGTTGGTCACTCTATGCGTGAATCGAACATCGTCCCCGTCGTACTGGGATGAGTCCTCAAGAGACCTTGTGTGATTGCAGCATCGCATGAAAGTGCCGTGTTCATCATATTGTGGCCCCAAGTCAGGCGAGGCCCACCCGCCGAGTTTAAGCA

Click for details-----ITS1

GTGAACCTGCGGAAGGATCATTGTTGAGAGTGCATTGAATGATGGATGGTTGCGAATGTGTCAACGTGCCCCTTTCCTTGCCCCATGTTGCTGGGCAATTGATCGTAGCTCGGTGCGATCGGCACCAAGGAATAATAAACTGAGAAGCAAAGGGCCCTCGGTGTGTGCGGGGAGCCCAATGCGTCGGAGAAGCCTCGAAATCAAA

Click for details-----ITS2

CATCGTCGCCTTTGCTCCTTGCTTTGCTGCTGGTGCTAAGTGCGGAAATTGGCCTCGTGTGCCCTCRGGCGAGGGCACAGTCGGTTGAAGAGTGGGTAGTCGGTAGACGTCGGGCRCGATGGGTGTTGGTCACTCTATGCGTGAATCGAACATCGTCCCCGTCGTACTGGGATGAGTCCTCAAGAGACCTTGTGTGATTGCAGCATCGCATGAAAGTGCCGTGTTCATCATATTGTGGCCCCAAGTCAGGCGAGGCCCACCCGCCGAGTTTAAGCA
Taxonomic Information

Plant ID: NPO5033
Plant Latin Name: Alpinia Galanga
Taxonomy Genus: Alpinia
Taxonomy Family: Zingiberaceae

Plant External Links:

NCBI TaxonomyDB: 94327
Plant-of-the-World-Online: 795279-1

Used in Medicines

Country/Region:
Indonesia; India; China; Jordan; Laos; Thailand

Traditional Medicine System:
Indian Folk; TCM; Unani; Ayurveda; Siddha

Geographical Distribution

Bangladesh; Myanmar; Philippines; Indonesia; India; Cambodia; Vietnam; Jordan; Laos; Sri Lanka; China; Taiwan; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

127 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


89 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

60 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9880

Ingredient ID: NPC98187

Ingredient ID: NPC97697

Ingredient ID: NPC9136

Ingredient ID: NPC88868

Ingredient ID: NPC87828

Ingredient ID: NPC86449

Ingredient ID: NPC82198

Ingredient ID: NPC80500

Ingredient ID: NPC79698

Ingredient ID: NPC79027

Ingredient ID: NPC78551

Ingredient ID: NPC75121

Ingredient ID: NPC72753

Ingredient ID: NPC71703

Ingredient ID: NPC71506

Ingredient ID: NPC68889

Ingredient ID: NPC68269

Ingredient ID: NPC67986

Ingredient ID: NPC66862

Ingredient ID: NPC55940

Ingredient ID: NPC55462

Ingredient ID: NPC469708

Ingredient ID: NPC44717

Ingredient ID: NPC4135

Ingredient ID: NPC3672

Ingredient ID: NPC36680

Ingredient ID: NPC3649

Ingredient ID: NPC328820

Ingredient ID: NPC325418

Ingredient ID: NPC31784

Ingredient ID: NPC315707

Ingredient ID: NPC3155

Ingredient ID: NPC303979

Ingredient ID: NPC303686

Ingredient ID: NPC303522

Ingredient ID: NPC29805

Ingredient ID: NPC292792

Ingredient ID: NPC292128

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC287871

Ingredient ID: NPC287331

Ingredient ID: NPC286006

Ingredient ID: NPC283789

Ingredient ID: NPC283546

Ingredient ID: NPC277569

Ingredient ID: NPC273607

Ingredient ID: NPC26906

Ingredient ID: NPC268169

Ingredient ID: NPC267064

Ingredient ID: NPC265789

Ingredient ID: NPC264143

Ingredient ID: NPC262697

Ingredient ID: NPC260501

Ingredient ID: NPC257124

Ingredient ID: NPC251666

Ingredient ID: NPC25067

Ingredient ID: NPC241838

Ingredient ID: NPC239039

Ingredient ID: NPC236261

Ingredient ID: NPC235250

Ingredient ID: NPC233881

Ingredient ID: NPC232042

Ingredient ID: NPC231324

Ingredient ID: NPC231251

Ingredient ID: NPC230677

Ingredient ID: NPC230301

Ingredient ID: NPC230298

Ingredient ID: NPC229143

Ingredient ID: NPC227670

Ingredient ID: NPC227378

Ingredient ID: NPC221155

Ingredient ID: NPC219810

Ingredient ID: NPC218074

Ingredient ID: NPC216921

Ingredient ID: NPC216331

Ingredient ID: NPC214584

Ingredient ID: NPC213749

Ingredient ID: NPC208747

Ingredient ID: NPC208519

Ingredient ID: NPC20490

Ingredient ID: NPC203646

Ingredient ID: NPC203583

Ingredient ID: NPC20183

Ingredient ID: NPC197649

Ingredient ID: NPC197467

Ingredient ID: NPC195282

Ingredient ID: NPC187432

Ingredient ID: NPC185116

Ingredient ID: NPC184033

Ingredient ID: NPC180871

Ingredient ID: NPC180823

Ingredient ID: NPC177294

Ingredient ID: NPC177112

Ingredient ID: NPC176305

Ingredient ID: NPC175585

Ingredient ID: NPC173996

Ingredient ID: NPC172833

Ingredient ID: NPC171843

Ingredient ID: NPC166496

Ingredient ID: NPC166362

Ingredient ID: NPC164625

Ingredient ID: NPC161162

Ingredient ID: NPC156750

Ingredient ID: NPC155393

Ingredient ID: NPC14930

Ingredient ID: NPC147513

Ingredient ID: NPC144360

Ingredient ID: NPC1423

Ingredient ID: NPC141875

Ingredient ID: NPC141777

Ingredient ID: NPC13991

Ingredient ID: NPC139546

Ingredient ID: NPC139478

Ingredient ID: NPC138885

Ingredient ID: NPC138113

Ingredient ID: NPC132102

Ingredient ID: NPC127453

Ingredient ID: NPC126458

Ingredient ID: NPC126240

Ingredient ID: NPC124106

Ingredient ID: NPC116161

Ingredient ID: NPC114239

Ingredient ID: NPC109533

Ingredient ID: NPC108431

Ingredient ID: NPC104216