• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Epimedium Brevicornu


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

GAACCTGCGGAAGGTACATTGTCAAAACCTGCAAAGCAGAACGACCAGCGAACTTGTGAAAAACACTTATGGGAGGGACGAAGGGTGCTAACCTTGAATCCTTCCTACTGGGTCACTTGGGACGATTGTGTCGTGAAAGCGACAACGACGCCCCTCGTTGATTCAAATAACAACTCGGCGCGGTCTGCGCCAAGGAAAATCTTAACGGATAGAGCACGTCTTCATGACGATGTTGTAATTCCGATCTTATAA

Click for details-----ITS2

ACAGCGTCGCTCCCACCATGATGCCTTTGTTCTGTTATCGGGCAACTGCAACGTGGCTTGGGAAGCGGATATTGGCCCCCCGTACCTTTGTAGGCGCGGCCGGCCTAAAATTCGGCCCTCGGCGACGAGCGTCACGATCAGTGGTGGTTGAATAACCCCTTTGTCATAGACCGGTATCGTGTTGTTTCGTCGTCTATTTGGGCCATATGGACCCTTGCGTGTCGTATAAACGGCATTCACTCTGCGACCCCAGGTCAGGCGG
Taxonomic Information

Plant ID: NPO4957
Plant Latin Name: Epimedium Brevicornu
Taxonomy Genus: Epimedium
Taxonomy Family: Berberidaceae

Plant External Links:

NCBI TaxonomyDB: 253618
Plant-of-the-World-Online: 107262-1

Used in Medicines

Unknown.

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

109 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


35 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

52 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98745

Ingredient ID: NPC98356

Ingredient ID: NPC97804

Ingredient ID: NPC92844

Ingredient ID: NPC9117

Ingredient ID: NPC88789

Ingredient ID: NPC79549

Ingredient ID: NPC77284

Ingredient ID: NPC76648

Ingredient ID: NPC72722

Ingredient ID: NPC70759

Ingredient ID: NPC67020

Ingredient ID: NPC66087

Ingredient ID: NPC65401

Ingredient ID: NPC62765

Ingredient ID: NPC62254

Ingredient ID: NPC61477

Ingredient ID: NPC60

Ingredient ID: NPC53722

Ingredient ID: NPC5319

Ingredient ID: NPC5173

Ingredient ID: NPC4920

Ingredient ID: NPC46924

Ingredient ID: NPC35565

Ingredient ID: NPC34103

Ingredient ID: NPC33511

Ingredient ID: NPC311256

Ingredient ID: NPC31092

Ingredient ID: NPC306590

Ingredient ID: NPC302857

Ingredient ID: NPC301217

Ingredient ID: NPC29883

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC292665

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC281131

Ingredient ID: NPC280403

Ingredient ID: NPC279121

Ingredient ID: NPC278419

Ingredient ID: NPC278068

Ingredient ID: NPC275463

Ingredient ID: NPC273538

Ingredient ID: NPC273125

Ingredient ID: NPC272697

Ingredient ID: NPC26782

Ingredient ID: NPC26229

Ingredient ID: NPC260736

Ingredient ID: NPC258994

Ingredient ID: NPC258552

Ingredient ID: NPC252558

Ingredient ID: NPC251065

Ingredient ID: NPC244351

Ingredient ID: NPC241891

Ingredient ID: NPC240735

Ingredient ID: NPC239687

Ingredient ID: NPC236709

Ingredient ID: NPC234560

Ingredient ID: NPC230301

Ingredient ID: NPC225710

Ingredient ID: NPC224714

Ingredient ID: NPC219913

Ingredient ID: NPC219876

Ingredient ID: NPC219053

Ingredient ID: NPC211773

Ingredient ID: NPC20791

Ingredient ID: NPC20763

Ingredient ID: NPC207386

Ingredient ID: NPC199191

Ingredient ID: NPC186653

Ingredient ID: NPC179950

Ingredient ID: NPC179198

Ingredient ID: NPC176740

Ingredient ID: NPC175819

Ingredient ID: NPC17155

Ingredient ID: NPC170324

Ingredient ID: NPC167976

Ingredient ID: NPC165159

Ingredient ID: NPC165157

Ingredient ID: NPC164700

Ingredient ID: NPC15658

Ingredient ID: NPC153572

Ingredient ID: NPC146374

Ingredient ID: NPC145858

Ingredient ID: NPC145038

Ingredient ID: NPC144764

Ingredient ID: NPC142931

Ingredient ID: NPC142703

Ingredient ID: NPC141768

Ingredient ID: NPC141765

Ingredient ID: NPC140939

Ingredient ID: NPC135088

Ingredient ID: NPC134829

Ingredient ID: NPC134796

Ingredient ID: NPC131745

Ingredient ID: NPC122740

Ingredient ID: NPC12053

Ingredient ID: NPC120464

Ingredient ID: NPC119307

Ingredient ID: NPC118377

Ingredient ID: NPC116775

Ingredient ID: NPC113212

Ingredient ID: NPC112438

Ingredient ID: NPC111929

Ingredient ID: NPC111888

Ingredient ID: NPC111101

Ingredient ID: NPC1075

Ingredient ID: NPC103264