• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Phaseolus Vulgaris


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GGACCTGCGGAAGGATCATTGTCGATGCCTCAAACAATTCCACCCGCGAATACGTACCAAACACACAACAACGCGCAAGGCCAGCGGGGGCACGCAAGTTCTCCCACTACCAAGTGCGTTGTCGAGAGCGGGGGTGGGCGTCTTGATGCCTTGTGCATCCGGTCGCAAACCCGTGTCTCCCGACAAAAACTAACCCCGGCGTTTTACGCGCCAAGGAAAACGAAGCTGTTAGGTGAGGCAAACGGGGGACGTGTCCCGCGGGCGCCTTCACGATGACATGTTATGTAAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACCGCCCCCCCACCGCTCCACTCGCGTCACGGCGCGAGTCGGTTCGAGTGAAAGTGGCCATCCCGGCGCGCGGGCTTTCCTCCCGAAAGGAAGGAAGGCCTTGAGAGTCGCAAGGGTTGGCTGAAATGGAGGGAATCGGCCGCCGTGGTGACGCAGTCCGCGATCGGGTGATCCGAGCTCCTTCGGGAGCCCGGAATATTTCTAAGTGCGTGGCTGCGTCCCCCAGTCGGTTGGGTTGCGAAAGCAGCCAGGTTACCTCGTGCAGGTCGAGCGCGCCCCCCGCGGCGCGCGTCACGC

Click for details-----ITS1

TTGGAAAGTAAAAATGAGTAAACAGGTTCCCGTAGGTTGACCTGGGGGAAGGTTCATGTCGATGCTTCAAACAACCTCAACCGGGAACACCGTCCAAACACACAAAACGCGCAAGGGCGGGCGGGGCCAGCAAGGGCTTCCAATTTCTAGCGCGTTCTTGAGAGCGGGGGGGGGCGGTCCCGATTGTTGCCTTGCGCTTCCATCCGGCTGCAAACCCGGTTTTCCCGCAAAAAAACCAACCCCGGCGTTTTACGCGCCAAGGAAAACGAAGCTGTTAGGTGAGGCAAACGGGGGACGTGTCCCGCGGGCGCCTTCACGACGACATGTTATGTAAAA

Click for details-----ITS2

ATCGTCACCCCTTCCTCCACACTTAACCAGTTAAATGTGAGGCAGTGGGTGAAAGTTGACCTCCCGCGAGCCAGTTCCTCGTGGTTGGTTGAAAAGCAAGTTCGGGGCGGAGTCCCCCGCGATAACGGTGGATGAGCCCACGCTCGAGACCAATCGTGCCTGTGGGACTCCGACGTAACGGACTTATCGACCCCACACGCGCCCTCTGTGCAAACCGAGTGTGCCATCTACGAGACCTCAGTCAGGCGACAGCAAGCTC
Taxonomic Information

Plant ID: NPO4934
Plant Latin Name: Phaseolus Vulgaris
Taxonomy Genus: Phaseolus
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 3885
Plant-of-the-World-Online: 514191-1

Used in Medicines

Country/Region:
Brazil; Turkey; Madagascar; Italy; South Africa; Lebanon; Indonesia; India; Mexico; Zimbabwe; Jordan; Swaziland; Angola; China; Russia; Spain

Traditional Medicine System:
Unani; Indian Folk; TCM; Homeopathy; Siddha


Medicinal Functions:

Cancer; Diuretic; Homeopathy; Hypoglycaemic; Hypotensive; Miscellany; Narcotic

Geographical Distribution

Brazil; Turkey; Madagascar; Italy; Bangladesh; Guinea; Nepal; Costa Rica; Mongolia; Ethiopia; Rwanda; Peru; Swaziland; Argentina; Bolivia; Cameroon; Nigeria; Ecuador; Turkmenistan; Belarus; Cuba; Venezuela; Zambia; Russia; Togo; Zimbabwe; China; Lebanon; Jordan; Haiti; Iraq; Kazakhstan; Tanzania; Spain; Ukraine; Uganda; Pakistan; Philippines; Indonesia; United States; Trinidad and Tobago; Australia; Thailand; Honduras; Dominican Republic; Jamaica; Angola; Myanmar; Chad; Mexico; Tajikistan; South Africa; India; Uzbekistan; Senegal; Vietnam; Colombia; Sri Lanka; Kenya; Nicaragua

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

177 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


102 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

115 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99717

Ingredient ID: NPC99088

Ingredient ID: NPC98028

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC87641

Ingredient ID: NPC86655

Ingredient ID: NPC85896

Ingredient ID: NPC85813

Ingredient ID: NPC83538

Ingredient ID: NPC81010

Ingredient ID: NPC78312

Ingredient ID: NPC73694

Ingredient ID: NPC64679

Ingredient ID: NPC64250

Ingredient ID: NPC62765

Ingredient ID: NPC62045

Ingredient ID: NPC60151

Ingredient ID: NPC59650

Ingredient ID: NPC58190

Ingredient ID: NPC55412

Ingredient ID: NPC5447

Ingredient ID: NPC5413

Ingredient ID: NPC52238

Ingredient ID: NPC49871

Ingredient ID: NPC491218

Ingredient ID: NPC490469

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC490401

Ingredient ID: NPC490375

Ingredient ID: NPC490368

Ingredient ID: NPC490332

Ingredient ID: NPC489939

Ingredient ID: NPC489928

Ingredient ID: NPC489910

Ingredient ID: NPC489909

Ingredient ID: NPC489908

Ingredient ID: NPC489907

Ingredient ID: NPC489904

Ingredient ID: NPC489901

Ingredient ID: NPC489899

Ingredient ID: NPC489875

Ingredient ID: NPC48623

Ingredient ID: NPC48342

Ingredient ID: NPC46274

Ingredient ID: NPC424

Ingredient ID: NPC39620

Ingredient ID: NPC39426

Ingredient ID: NPC37793

Ingredient ID: NPC328788

Ingredient ID: NPC328478

Ingredient ID: NPC328447

Ingredient ID: NPC324750

Ingredient ID: NPC322254

Ingredient ID: NPC321850

Ingredient ID: NPC319667

Ingredient ID: NPC317120

Ingredient ID: NPC316926

Ingredient ID: NPC313955

Ingredient ID: NPC311987

Ingredient ID: NPC310601

Ingredient ID: NPC309330

Ingredient ID: NPC302857

Ingredient ID: NPC300933

Ingredient ID: NPC300326

Ingredient ID: NPC300059

Ingredient ID: NPC299704

Ingredient ID: NPC295644

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC293628

Ingredient ID: NPC293203

Ingredient ID: NPC291650

Ingredient ID: NPC291473

Ingredient ID: NPC290319

Ingredient ID: NPC281686

Ingredient ID: NPC280717

Ingredient ID: NPC279865

Ingredient ID: NPC279661

Ingredient ID: NPC279121

Ingredient ID: NPC279026

Ingredient ID: NPC27836

Ingredient ID: NPC27797

Ingredient ID: NPC277867

Ingredient ID: NPC27641

Ingredient ID: NPC272614

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC2660

Ingredient ID: NPC265885

Ingredient ID: NPC265305

Ingredient ID: NPC264395

Ingredient ID: NPC263727

Ingredient ID: NPC261831

Ingredient ID: NPC260837

Ingredient ID: NPC251791

Ingredient ID: NPC246558

Ingredient ID: NPC245346

Ingredient ID: NPC242580

Ingredient ID: NPC237812

Ingredient ID: NPC236202

Ingredient ID: NPC235260

Ingredient ID: NPC234560

Ingredient ID: NPC232080

Ingredient ID: NPC229942

Ingredient ID: NPC226453

Ingredient ID: NPC226027

Ingredient ID: NPC225710

Ingredient ID: NPC225696

Ingredient ID: NPC220825

Ingredient ID: NPC220765

Ingredient ID: NPC219876

Ingredient ID: NPC219539

Ingredient ID: NPC219143

Ingredient ID: NPC213876

Ingredient ID: NPC208793

Ingredient ID: NPC20791

Ingredient ID: NPC203468

Ingredient ID: NPC201844

Ingredient ID: NPC201284

Ingredient ID: NPC199072

Ingredient ID: NPC197087

Ingredient ID: NPC196776

Ingredient ID: NPC196749

Ingredient ID: NPC193989

Ingredient ID: NPC192248

Ingredient ID: NPC190501

Ingredient ID: NPC190454

Ingredient ID: NPC189436

Ingredient ID: NPC188428

Ingredient ID: NPC187770

Ingredient ID: NPC185755

Ingredient ID: NPC181574

Ingredient ID: NPC180905

Ingredient ID: NPC17810

Ingredient ID: NPC176740

Ingredient ID: NPC174246

Ingredient ID: NPC173637

Ingredient ID: NPC173365

Ingredient ID: NPC169749

Ingredient ID: NPC168579

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC164614

Ingredient ID: NPC161700

Ingredient ID: NPC161593

Ingredient ID: NPC156980

Ingredient ID: NPC156654

Ingredient ID: NPC155263

Ingredient ID: NPC154186

Ingredient ID: NPC154139

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC149803

Ingredient ID: NPC147983

Ingredient ID: NPC146422

Ingredient ID: NPC137958

Ingredient ID: NPC137167

Ingredient ID: NPC136014

Ingredient ID: NPC135539

Ingredient ID: NPC133671

Ingredient ID: NPC133183

Ingredient ID: NPC130683

Ingredient ID: NPC127624

Ingredient ID: NPC126681

Ingredient ID: NPC125062

Ingredient ID: NPC118429

Ingredient ID: NPC116775

Ingredient ID: NPC11433

Ingredient ID: NPC112890

Ingredient ID: NPC111888

Ingredient ID: NPC110899

Ingredient ID: NPC110557

Ingredient ID: NPC108831

Ingredient ID: NPC108811

Ingredient ID: NPC100971