• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Scrophularia Ningpoensis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCAAAGCAGACCGTGAACTTGTGTTTTTAACCATATAGGGGCCGCGGCCCCATCCCCCGCTGGCGAGCGCGCGAGCGACCGTCGTGCGGGCTAACGAACCCCCGGCGCGGCATGCGCCAAGGAAAACTCAACGAAGCGCCTCCCCATCGATGCCCCGTTCGCGATGTGCTCGGTGGGACAGTGCGTCTCTTGAATGTCATAACGACTCTCGGCAACGGATATCTAGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCTCCCAATCCCTTGGGATACAGAGAGGGGCGGATATTGGCCTCCCGTGCTCTTTGGTGCGCGGCCGGCCCAAATGTGATCCCGCGTCGACGCGAGTCACGACCAGTGGTGGTTGATTCCTCAACTCGCGTGCTGTCGTGCCGTATTGCGTCGTTCGTTTGGGCATCGTCGTAGACCCAAAAGGTGCTCTCGAGTGCCTTCGAC

Click for details-----ITS1

TCGAAACCTGCAAAGCAGACCGTGAACTTGTGTTTTTAACCATATAGGGGCCGCGGCCCCATCCCCCGCTGGCGAGCGCGCGAGCGACCGTCGTGCGGGCTAACGAACCCCCGGCGCGGCATGCGCCAAGGAAAACTCAACGAAGCGCCTCCCCATCGATGCCCCGTTCGCGATGTGCTCGGTGGGACAGTGCGTCTCTTGAATGTCATAA

Click for details-----ITS2

ATCGCGTCGCCCCCCTCCCAATCCCTTGGGATACAGAGAGGGGCGGATATTGGCCTCCCGTGCTCTTTGGTGTGCGGCCGGCCCAAATGTGATCCCGCGTCGACGCGAGTCACGACCAGTGGTGGTTGATTCCTCAACTCGCGTGCTGTCGTGCCGTATTGCGTCGTTCGTTTGGGCATCGTCGTAGACCCAAAAGGTGCTCTCGAGTGCCTTCGACCGCGACCCC
Taxonomic Information

Plant ID: NPO4802
Plant Latin Name: Scrophularia Ningpoensis
Taxonomy Genus: Scrophularia
Taxonomy Family: Scrophulariaceae

Plant External Links:

NCBI TaxonomyDB: 291326
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM


Medicinal Functions:

Antibacterial; Antifungal; Antiphlogistic; Antipyretic; Cardiac; Diuretic; Febrifuge; Haemolytic; Hypoglycaemic; Restorative; Sialagogue; Tonic; Vasodilator

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

96 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


55 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

32 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC92647

Ingredient ID: NPC89900

Ingredient ID: NPC89121

Ingredient ID: NPC8364

Ingredient ID: NPC82026

Ingredient ID: NPC81010

Ingredient ID: NPC77156

Ingredient ID: NPC74361

Ingredient ID: NPC71853

Ingredient ID: NPC70744

Ingredient ID: NPC70741

Ingredient ID: NPC62765

Ingredient ID: NPC62469

Ingredient ID: NPC60583

Ingredient ID: NPC47481

Ingredient ID: NPC46540

Ingredient ID: NPC424

Ingredient ID: NPC41476

Ingredient ID: NPC36061

Ingredient ID: NPC34927

Ingredient ID: NPC34908

Ingredient ID: NPC34587

Ingredient ID: NPC32977

Ingredient ID: NPC329148

Ingredient ID: NPC322423

Ingredient ID: NPC310905

Ingredient ID: NPC305449

Ingredient ID: NPC304152

Ingredient ID: NPC294548

Ingredient ID: NPC291309

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC289758

Ingredient ID: NPC284538

Ingredient ID: NPC283823

Ingredient ID: NPC278642

Ingredient ID: NPC276047

Ingredient ID: NPC271027

Ingredient ID: NPC267733

Ingredient ID: NPC263804

Ingredient ID: NPC261831

Ingredient ID: NPC258320

Ingredient ID: NPC257124

Ingredient ID: NPC256703

Ingredient ID: NPC2518

Ingredient ID: NPC2517

Ingredient ID: NPC2499

Ingredient ID: NPC245106

Ingredient ID: NPC244601

Ingredient ID: NPC236788

Ingredient ID: NPC233858

Ingredient ID: NPC230301

Ingredient ID: NPC223695

Ingredient ID: NPC223002

Ingredient ID: NPC219449

Ingredient ID: NPC214153

Ingredient ID: NPC211445

Ingredient ID: NPC208057

Ingredient ID: NPC207306

Ingredient ID: NPC206800

Ingredient ID: NPC203719

Ingredient ID: NPC200812

Ingredient ID: NPC200053

Ingredient ID: NPC199561

Ingredient ID: NPC197316

Ingredient ID: NPC194953

Ingredient ID: NPC183600

Ingredient ID: NPC180058

Ingredient ID: NPC179694

Ingredient ID: NPC176029

Ingredient ID: NPC171484

Ingredient ID: NPC171280

Ingredient ID: NPC171158

Ingredient ID: NPC169577

Ingredient ID: NPC166956

Ingredient ID: NPC162762

Ingredient ID: NPC156461

Ingredient ID: NPC153370

Ingredient ID: NPC151898

Ingredient ID: NPC1507

Ingredient ID: NPC149018

Ingredient ID: NPC142753

Ingredient ID: NPC139029

Ingredient ID: NPC136699

Ingredient ID: NPC127513

Ingredient ID: NPC12690

Ingredient ID: NPC124746

Ingredient ID: NPC120914

Ingredient ID: NPC12025

Ingredient ID: NPC115160

Ingredient ID: NPC113219

Ingredient ID: NPC110899

Ingredient ID: NPC107482

Ingredient ID: NPC10251

Ingredient ID: NPC10209

Ingredient ID: NPC101466