• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Prunus Armeniaca


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TTCGTAGTGACCTGCGGAGGATCATTGTCGAAACCTGCCTAGCAGAACGACCCGAGAACTAGTTTCAAAGCGGGGGACGAGGGGCCGTCTCGGCGTGCTCCTCGTCCCTTTATCTCGGGGGGGTTCATACCCTTCCGGGCGTACAAACGAACACCGGCGCGAATTGCGCCAAGGAACTTGAACGAGAGAGCGCGTCCCCGTCGCCCCGGAAACGGTGTGCGCGGGCGGCGTCGTCATCTTCAAATATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACACGTCGTTGCCCCCCCATCTACTCCTTCGGGATTGCGGGGGGCGGATGATGGCCTCCCGTGCGCCTCGTCGCGCGGTTGGCATAAATGCCAAGTCCTCGGCGACGCACGCCACGACAATCGGTGGTTGCGAAACCTCGGTTGCCCGTCGTGTGCGGTCGTCGCGCATCGAGGGCTCGAAAAAATTGCCGGGCTCCTGCTCGGCTTCAACGCGACCCCAGTCAGGCGGTACCCGA

Click for details-----ITS1

TTAAAGTAGCGACTGCGGAGACATTGTCGAACCTGAAGCAGGCCTAGCAGAACGACCCGAGAACTAGTTTCAAAGCGGGGGATGATGGACAGCCTGTGACGAGGGGCCGTCTCGGCGTGCTCCTCGTCCCTTTATCTCGGGGGGGTTCATACCCTTCCGGGCGGTACAAACGAACACCGGCGCGAATTGCGCCAAGGAACTTGAACGAAAGAACGCGTCCTCGTCGCCCCGGAAACGGTGTGCGATGGGGGCGTCGTCATCTTCAAATATGTCAAAA

Click for details-----ITS2

GTCGTTGCCCCCCCATCTACTCCTTCGGGATTGCGGGGGGCGGATGATGGCCTCCCGTGCGCCTCGTCGCGCGGTTGGCATAAATGCCAAGTCCTCGGCGACGCACGCCACGACAATCGGTGGTTGCGAAACCTCGGTTGCCCGTCGTGTGCGGTCGTCGCGCATCGAGGGCTCGAAAAAATTGCCGGGCTCCTGCTCGGCTTCAACGCGACCCCAGTCAGGCGGTACCCGA
Taxonomic Information

Plant ID: NPO4795
Plant Latin Name: Prunus Armeniaca
Taxonomy Genus: Prunus
Taxonomy Family: Rosaceae

Plant External Links:

NCBI TaxonomyDB: 36596
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Turkey; Italy; China; India

Traditional Medicine System:
TCM; Unani; Ayurveda; Kampo


Medicinal Functions:

Analgesic; Anthelmintic; Antiasthmatic; Antidote; Antipyretic; Antiseptic; Antispasmodic; Antitussive; Demulcent; Emetic; Emollient; Expectorant; Laxative; Ophthalmic; Pectoral; Sedative; Tonic; Vulnerary

Geographical Distribution

Turkey; India; Italy; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

207 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


125 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

122 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99734

Ingredient ID: NPC98356

Ingredient ID: NPC96123

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC91511

Ingredient ID: NPC88566

Ingredient ID: NPC86412

Ingredient ID: NPC85813

Ingredient ID: NPC85488

Ingredient ID: NPC81010

Ingredient ID: NPC78500

Ingredient ID: NPC77272

Ingredient ID: NPC75204

Ingredient ID: NPC7133

Ingredient ID: NPC69750

Ingredient ID: NPC69445

Ingredient ID: NPC68889

Ingredient ID: NPC68779

Ingredient ID: NPC68517

Ingredient ID: NPC65326

Ingredient ID: NPC63182

Ingredient ID: NPC62765

Ingredient ID: NPC62045

Ingredient ID: NPC61066

Ingredient ID: NPC60151

Ingredient ID: NPC59650

Ingredient ID: NPC59581

Ingredient ID: NPC58957

Ingredient ID: NPC58792

Ingredient ID: NPC58190

Ingredient ID: NPC55412

Ingredient ID: NPC52700

Ingredient ID: NPC52309

Ingredient ID: NPC51855

Ingredient ID: NPC491304

Ingredient ID: NPC491294

Ingredient ID: NPC491291

Ingredient ID: NPC491276

Ingredient ID: NPC491218

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC490383

Ingredient ID: NPC490344

Ingredient ID: NPC489948

Ingredient ID: NPC489907

Ingredient ID: NPC48623

Ingredient ID: NPC48347

Ingredient ID: NPC47654

Ingredient ID: NPC424

Ingredient ID: NPC39426

Ingredient ID: NPC36517

Ingredient ID: NPC3649

Ingredient ID: NPC36061

Ingredient ID: NPC35565

Ingredient ID: NPC33489

Ingredient ID: NPC328447

Ingredient ID: NPC319713

Ingredient ID: NPC317120

Ingredient ID: NPC316929

Ingredient ID: NPC315877

Ingredient ID: NPC314434

Ingredient ID: NPC313955

Ingredient ID: NPC310820

Ingredient ID: NPC306296

Ingredient ID: NPC303644

Ingredient ID: NPC302857

Ingredient ID: NPC301585

Ingredient ID: NPC295777

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC294289

Ingredient ID: NPC293378

Ingredient ID: NPC290495

Ingredient ID: NPC290319

Ingredient ID: NPC290287

Ingredient ID: NPC289668

Ingredient ID: NPC281686

Ingredient ID: NPC281335

Ingredient ID: NPC280749

Ingredient ID: NPC279865

Ingredient ID: NPC278068

Ingredient ID: NPC278021

Ingredient ID: NPC273858

Ingredient ID: NPC273545

Ingredient ID: NPC272614

Ingredient ID: NPC27184

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC26906

Ingredient ID: NPC266389

Ingredient ID: NPC2660

Ingredient ID: NPC265885

Ingredient ID: NPC265305

Ingredient ID: NPC263334

Ingredient ID: NPC261831

Ingredient ID: NPC259182

Ingredient ID: NPC258314

Ingredient ID: NPC257582

Ingredient ID: NPC256816

Ingredient ID: NPC254696

Ingredient ID: NPC252553

Ingredient ID: NPC248053

Ingredient ID: NPC246558

Ingredient ID: NPC24625

Ingredient ID: NPC242580

Ingredient ID: NPC241721

Ingredient ID: NPC237812

Ingredient ID: NPC230301

Ingredient ID: NPC228346

Ingredient ID: NPC226453

Ingredient ID: NPC226027

Ingredient ID: NPC222781

Ingredient ID: NPC219876

Ingredient ID: NPC219143

Ingredient ID: NPC216630

Ingredient ID: NPC216605

Ingredient ID: NPC214399

Ingredient ID: NPC213876

Ingredient ID: NPC211237

Ingredient ID: NPC209970

Ingredient ID: NPC208936

Ingredient ID: NPC208793

Ingredient ID: NPC208620

Ingredient ID: NPC208363

Ingredient ID: NPC208075

Ingredient ID: NPC20791

Ingredient ID: NPC206807

Ingredient ID: NPC205334

Ingredient ID: NPC203468

Ingredient ID: NPC201814

Ingredient ID: NPC201562

Ingredient ID: NPC201284

Ingredient ID: NPC199072

Ingredient ID: NPC199024

Ingredient ID: NPC197661

Ingredient ID: NPC197356

Ingredient ID: NPC196924

Ingredient ID: NPC192402

Ingredient ID: NPC189436

Ingredient ID: NPC189226

Ingredient ID: NPC187993

Ingredient ID: NPC187770

Ingredient ID: NPC187605

Ingredient ID: NPC186653

Ingredient ID: NPC185755

Ingredient ID: NPC183993

Ingredient ID: NPC182395

Ingredient ID: NPC18205

Ingredient ID: NPC181465

Ingredient ID: NPC181314

Ingredient ID: NPC181153

Ingredient ID: NPC180871

Ingredient ID: NPC179950

Ingredient ID: NPC179092

Ingredient ID: NPC17810

Ingredient ID: NPC176740

Ingredient ID: NPC175378

Ingredient ID: NPC17481

Ingredient ID: NPC174246

Ingredient ID: NPC171385

Ingredient ID: NPC168707

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC165525

Ingredient ID: NPC164700

Ingredient ID: NPC164487

Ingredient ID: NPC162742

Ingredient ID: NPC160126

Ingredient ID: NPC158040

Ingredient ID: NPC152451

Ingredient ID: NPC152438

Ingredient ID: NPC150950

Ingredient ID: NPC14950

Ingredient ID: NPC149184

Ingredient ID: NPC147983

Ingredient ID: NPC146197

Ingredient ID: NPC145373

Ingredient ID: NPC144109

Ingredient ID: NPC139029

Ingredient ID: NPC137958

Ingredient ID: NPC136014

Ingredient ID: NPC130683

Ingredient ID: NPC128410

Ingredient ID: NPC126759

Ingredient ID: NPC126741

Ingredient ID: NPC126681

Ingredient ID: NPC126029

Ingredient ID: NPC125144

Ingredient ID: NPC124673

Ingredient ID: NPC123871

Ingredient ID: NPC122768

Ingredient ID: NPC122245

Ingredient ID: NPC120817

Ingredient ID: NPC120233

Ingredient ID: NPC120217

Ingredient ID: NPC119949

Ingredient ID: NPC119817

Ingredient ID: NPC116775

Ingredient ID: NPC11433

Ingredient ID: NPC113733

Ingredient ID: NPC112941

Ingredient ID: NPC112890

Ingredient ID: NPC108811

Ingredient ID: NPC108779

Ingredient ID: NPC102280

Ingredient ID: NPC100128