• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Aglaia Perviridis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGTTGCCCTCCAAAAACCCCTCCCAGGGGATCGTTGGGCGGCGGAAACTGGCCTCCCGTGCGCTGCCAGCTCGCGGTTGGCCCAAATTCTAGCCCCTCGGCGACCGTGCCGCGACGATCGGTGGTGAAATGAACCTCTCGAACTCCCGTCGCGTGCTCGCGTCCTCGTGTTATGGGCTCGCGGACCCTTCGAGTGCCTTCTATCTCTGGCGCTGCTAGCT
Taxonomic Information

Plant ID: NPO4720
Plant Latin Name: Aglaia Perviridis
Taxonomy Genus: Aglaia
Taxonomy Family: Meliaceae

Plant External Links:

NCBI TaxonomyDB: 306512
Plant-of-the-World-Online: 577254-1

Used in Medicines

Unknown.

Geographical Distribution

India; Vietnam; China; Bangladesh; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

74 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


48 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

56 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC93864

Ingredient ID: NPC93641

Ingredient ID: NPC91947

Ingredient ID: NPC90336

Ingredient ID: NPC87633

Ingredient ID: NPC78324

Ingredient ID: NPC76336

Ingredient ID: NPC7343

Ingredient ID: NPC73422

Ingredient ID: NPC70982

Ingredient ID: NPC70869

Ingredient ID: NPC68795

Ingredient ID: NPC67872

Ingredient ID: NPC6530

Ingredient ID: NPC62082

Ingredient ID: NPC58631

Ingredient ID: NPC52464

Ingredient ID: NPC51543

Ingredient ID: NPC479787

Ingredient ID: NPC479786

Ingredient ID: NPC479785

Ingredient ID: NPC479784

Ingredient ID: NPC479783

Ingredient ID: NPC47486

Ingredient ID: NPC471447

Ingredient ID: NPC470937

Ingredient ID: NPC470936

Ingredient ID: NPC41331

Ingredient ID: NPC39154

Ingredient ID: NPC39045

Ingredient ID: NPC385

Ingredient ID: NPC3642

Ingredient ID: NPC308240

Ingredient ID: NPC307776

Ingredient ID: NPC306420

Ingredient ID: NPC299744

Ingredient ID: NPC296841

Ingredient ID: NPC292370

Ingredient ID: NPC291449

Ingredient ID: NPC276905

Ingredient ID: NPC276863

Ingredient ID: NPC273842

Ingredient ID: NPC273023

Ingredient ID: NPC263955

Ingredient ID: NPC246974

Ingredient ID: NPC243083

Ingredient ID: NPC24216

Ingredient ID: NPC236675

Ingredient ID: NPC23593

Ingredient ID: NPC230704

Ingredient ID: NPC230301

Ingredient ID: NPC217954

Ingredient ID: NPC208011

Ingredient ID: NPC195986

Ingredient ID: NPC193699

Ingredient ID: NPC193673

Ingredient ID: NPC191768

Ingredient ID: NPC189730

Ingredient ID: NPC186858

Ingredient ID: NPC184607

Ingredient ID: NPC171928

Ingredient ID: NPC164152

Ingredient ID: NPC162867

Ingredient ID: NPC159150

Ingredient ID: NPC147247

Ingredient ID: NPC132345

Ingredient ID: NPC12722

Ingredient ID: NPC116232

Ingredient ID: NPC115601

Ingredient ID: NPC114236

Ingredient ID: NPC113733

Ingredient ID: NPC109183

Ingredient ID: NPC107739

Ingredient ID: NPC103947