• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Trichosanthes Rosthornii


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGATGCCTAAACATCAAACGACCCGCGAACATGTTCACGAAACTGGGGGCTTAGTGGTCCATCGTGGCCATTGCGCCCCCAAGCCGAGTGAGTGTTGCATGCTTTGCGTGCTTCCCTCCTTGGTAAACAAACCAAACCACGGCGCAGGTCGCGCCAAGGAACATCAACATGATCGCTTGCCCTCAACCCCGACCTCGGTGTGTTGTGGGCAATGCATTCTGTCGTATTCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCATCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCTCATGCAACCCCCCATCAATAATCGATGTGGGGCTGGCATGGAGGCACACATTGGTCTCCCGTGTGCACCGTCACACGGATGGCTTAAATCTGAGACCTCGGCGCCTGGCGTCGTGACACAACGGTGGTTGATCAAAACCTCGGCACCGCGTCACGACCCTAGGCTGCACCATCGAGGCCTCTTCGACCCTCTGAATGTCATCACTGACGATGCTCTCG

Click for details-----ITS1

NA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO4702
Plant Latin Name: Trichosanthes Rosthornii
Taxonomy Genus: Trichosanthes
Taxonomy Family: Cucurbitaceae

Plant External Links:

NCBI TaxonomyDB: 676073
Plant-of-the-World-Online: 294288-1

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

81 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


45 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

47 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98555

Ingredient ID: NPC96835

Ingredient ID: NPC94699

Ingredient ID: NPC87463

Ingredient ID: NPC85948

Ingredient ID: NPC85813

Ingredient ID: NPC85473

Ingredient ID: NPC73855

Ingredient ID: NPC7363

Ingredient ID: NPC52005

Ingredient ID: NPC51580

Ingredient ID: NPC50898

Ingredient ID: NPC36061

Ingredient ID: NPC35565

Ingredient ID: NPC329148

Ingredient ID: NPC324914

Ingredient ID: NPC32021

Ingredient ID: NPC311612

Ingredient ID: NPC302813

Ingredient ID: NPC301585

Ingredient ID: NPC299856

Ingredient ID: NPC296651

Ingredient ID: NPC294548

Ingredient ID: NPC292869

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC289990

Ingredient ID: NPC285306

Ingredient ID: NPC279121

Ingredient ID: NPC279026

Ingredient ID: NPC26974

Ingredient ID: NPC26229

Ingredient ID: NPC261080

Ingredient ID: NPC260392

Ingredient ID: NPC260052

Ingredient ID: NPC258000

Ingredient ID: NPC257342

Ingredient ID: NPC255345

Ingredient ID: NPC240431

Ingredient ID: NPC240336

Ingredient ID: NPC24031

Ingredient ID: NPC230301

Ingredient ID: NPC22832

Ingredient ID: NPC22602

Ingredient ID: NPC225783

Ingredient ID: NPC223729

Ingredient ID: NPC216630

Ingredient ID: NPC21209

Ingredient ID: NPC210003

Ingredient ID: NPC209970

Ingredient ID: NPC20791

Ingredient ID: NPC201844

Ingredient ID: NPC199024

Ingredient ID: NPC189142

Ingredient ID: NPC185189

Ingredient ID: NPC184171

Ingredient ID: NPC183950

Ingredient ID: NPC181153

Ingredient ID: NPC179155

Ingredient ID: NPC176740

Ingredient ID: NPC176017

Ingredient ID: NPC173637

Ingredient ID: NPC169749

Ingredient ID: NPC165967

Ingredient ID: NPC164700

Ingredient ID: NPC163866

Ingredient ID: NPC156461

Ingredient ID: NPC154186

Ingredient ID: NPC153958

Ingredient ID: NPC140939

Ingredient ID: NPC139029

Ingredient ID: NPC135353

Ingredient ID: NPC124318

Ingredient ID: NPC119949

Ingredient ID: NPC118284

Ingredient ID: NPC11651

Ingredient ID: NPC113733

Ingredient ID: NPC111888

Ingredient ID: NPC107482

Ingredient ID: NPC101475

Ingredient ID: NPC100300