• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Lindera Aggregata


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TTACCACCACCGGCAACCAGAGTCCCGCGGAAACGTCGCTCGCGGCGCGCGGCCCCGGGGATGACCCGGGGGGGCGCGTCCCGACGAGCTCCGAACAACCCTTTGGGCGCGGCGAGCGCCAAGGAATAGAAGCGGAAAGGGCGGCCGCCTCAGCCCGGTGCGAGCGCGCCCCGTCCGGGGACGCGGCTTCGCGCCGTGGGGATACGCCGCCCGTCTGTGAACCATTTTATAGACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCACTCGGCCGAGGGCACGCCTGCCTGGGCGTCACGCCACCCATCGCCCCCCCTCGAGGCACTCCCGTGCACCGCCGGGGAGCGGAGACTGGCCGTCCGTGCCCGAGTCCTCGGCGCGCGGTCGGCAGAAAAGGAGGACACCGTGCGGCGCGACACGGCGTGTGGGGGTTGAGAGGCGATTCGTCGCCGATCGTACGTCGCGCCCGCATTCCGCCGCGCGCAGTGCCACCCGTGGGACCAGACCAGCCCGCAGCCGCGGGCGCTCGGA

Click for details-----ITS1

TTACCACCACCGGCAACCAGAGTCCCGCGGAAACGTCGCTCGCGGCGCGCGGCCCCGGGGATGACCCGGGGGGGCGCGTCCCGACGAGCTCCGAACAACCCTTTGGGCGCGGCGAGCGCCAAGGAATAGAAGCGGAAAGGGCGGCCGCCTCAGCCCGGTGCGAGCGCGCCCCGTCCGGGGACGCGGCTTCGCGCCGTGGGGATACGCCGCCCGTCTGTGAACCATTTTATAGA

Click for details-----ITS2

CACCCATCGCCCCCCCTCGAGGCACTCCCGTGCACCGCCGGGGAGCGGAGACTGGCCGTCCGTGCCCGAGTCCTCGGCGCGCGGTCGGCAGAAAAGGAGGACACCGTGCGGCGCGACACGGCGTGTGGGGGTTGAGAGGCGATTCGTCGCCGATCGTACGTCGCGCCCGCATTCCGCCGCGCGCAGTGCCACCCGTGGGACCAGACCAGCCCGCAGCCGCGGGCGCTCGGACCGCGAC
Taxonomic Information

Plant ID: NPO4682
Plant Latin Name: Lindera Aggregata
Taxonomy Genus: Lindera
Taxonomy Family: Lauraceae

Plant External Links:

NCBI TaxonomyDB: 545644
Plant-of-the-World-Online: 465318-1

Used in Medicines

Unknown.

Geographical Distribution

Philippines; Vietnam; China; Taiwan

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

215 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


186 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

89 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99707

Ingredient ID: NPC9880

Ingredient ID: NPC96630

Ingredient ID: NPC95969

Ingredient ID: NPC95468

Ingredient ID: NPC94245

Ingredient ID: NPC9424

Ingredient ID: NPC93850

Ingredient ID: NPC92197

Ingredient ID: NPC91574

Ingredient ID: NPC90889

Ingredient ID: NPC90803

Ingredient ID: NPC90506

Ingredient ID: NPC90185

Ingredient ID: NPC89069

Ingredient ID: NPC88566

Ingredient ID: NPC87828

Ingredient ID: NPC84479

Ingredient ID: NPC83301

Ingredient ID: NPC80090

Ingredient ID: NPC78551

Ingredient ID: NPC76145

Ingredient ID: NPC75584

Ingredient ID: NPC75158

Ingredient ID: NPC74914

Ingredient ID: NPC73137

Ingredient ID: NPC72504

Ingredient ID: NPC71703

Ingredient ID: NPC71506

Ingredient ID: NPC67986

Ingredient ID: NPC67761

Ingredient ID: NPC66595

Ingredient ID: NPC66577

Ingredient ID: NPC65412

Ingredient ID: NPC64332

Ingredient ID: NPC64176

Ingredient ID: NPC64034

Ingredient ID: NPC64008

Ingredient ID: NPC61828

Ingredient ID: NPC61769

Ingredient ID: NPC57268

Ingredient ID: NPC54264

Ingredient ID: NPC53720

Ingredient ID: NPC51758

Ingredient ID: NPC51681

Ingredient ID: NPC51189

Ingredient ID: NPC48764

Ingredient ID: NPC47946

Ingredient ID: NPC45727

Ingredient ID: NPC44751

Ingredient ID: NPC43728

Ingredient ID: NPC43114

Ingredient ID: NPC4296

Ingredient ID: NPC428

Ingredient ID: NPC41385

Ingredient ID: NPC40249

Ingredient ID: NPC39641

Ingredient ID: NPC39068

Ingredient ID: NPC390

Ingredient ID: NPC38105

Ingredient ID: NPC37871

Ingredient ID: NPC3649

Ingredient ID: NPC34764

Ingredient ID: NPC34440

Ingredient ID: NPC34395

Ingredient ID: NPC32411

Ingredient ID: NPC3155

Ingredient ID: NPC310478

Ingredient ID: NPC308218

Ingredient ID: NPC306843

Ingredient ID: NPC301972

Ingredient ID: NPC300649

Ingredient ID: NPC297422

Ingredient ID: NPC297148

Ingredient ID: NPC296451

Ingredient ID: NPC295998

Ingredient ID: NPC295403

Ingredient ID: NPC292092

Ingredient ID: NPC291647

Ingredient ID: NPC29091

Ingredient ID: NPC290189

Ingredient ID: NPC290078

Ingredient ID: NPC289120

Ingredient ID: NPC288991

Ingredient ID: NPC287331

Ingredient ID: NPC285223

Ingredient ID: NPC284731

Ingredient ID: NPC283655

Ingredient ID: NPC280965

Ingredient ID: NPC280399

Ingredient ID: NPC277907

Ingredient ID: NPC277736

Ingredient ID: NPC277693

Ingredient ID: NPC26960

Ingredient ID: NPC26906

Ingredient ID: NPC267285

Ingredient ID: NPC267077

Ingredient ID: NPC26639

Ingredient ID: NPC26544

Ingredient ID: NPC264779

Ingredient ID: NPC26240

Ingredient ID: NPC257790

Ingredient ID: NPC255042

Ingredient ID: NPC254770

Ingredient ID: NPC254156

Ingredient ID: NPC253714

Ingredient ID: NPC252655

Ingredient ID: NPC249815

Ingredient ID: NPC249407

Ingredient ID: NPC248795

Ingredient ID: NPC24327

Ingredient ID: NPC243089

Ingredient ID: NPC24238

Ingredient ID: NPC239037

Ingredient ID: NPC233529

Ingredient ID: NPC233473

Ingredient ID: NPC233224

Ingredient ID: NPC232803

Ingredient ID: NPC232375

Ingredient ID: NPC231331

Ingredient ID: NPC230548

Ingredient ID: NPC230298

Ingredient ID: NPC227670

Ingredient ID: NPC22760

Ingredient ID: NPC227378

Ingredient ID: NPC226871

Ingredient ID: NPC226762

Ingredient ID: NPC225550

Ingredient ID: NPC22484

Ingredient ID: NPC224777

Ingredient ID: NPC220860

Ingredient ID: NPC22028

Ingredient ID: NPC220228

Ingredient ID: NPC218918

Ingredient ID: NPC216921

Ingredient ID: NPC216900

Ingredient ID: NPC216810

Ingredient ID: NPC214909

Ingredient ID: NPC214584

Ingredient ID: NPC212208

Ingredient ID: NPC209279

Ingredient ID: NPC208899

Ingredient ID: NPC20791

Ingredient ID: NPC204120

Ingredient ID: NPC203634

Ingredient ID: NPC203468

Ingredient ID: NPC199850

Ingredient ID: NPC199267

Ingredient ID: NPC198658

Ingredient ID: NPC198586

Ingredient ID: NPC197422

Ingredient ID: NPC196490

Ingredient ID: NPC196442

Ingredient ID: NPC195986

Ingredient ID: NPC194586

Ingredient ID: NPC193180

Ingredient ID: NPC192521

Ingredient ID: NPC191783

Ingredient ID: NPC191483

Ingredient ID: NPC190810

Ingredient ID: NPC189853

Ingredient ID: NPC189036

Ingredient ID: NPC188334

Ingredient ID: NPC188238

Ingredient ID: NPC183987

Ingredient ID: NPC182840

Ingredient ID: NPC180684

Ingredient ID: NPC178777

Ingredient ID: NPC178382

Ingredient ID: NPC178223

Ingredient ID: NPC177112

Ingredient ID: NPC17704

Ingredient ID: NPC175913

Ingredient ID: NPC174191

Ingredient ID: NPC174125

Ingredient ID: NPC173996

Ingredient ID: NPC166894

Ingredient ID: NPC166362

Ingredient ID: NPC165632

Ingredient ID: NPC165161

Ingredient ID: NPC164023

Ingredient ID: NPC163556

Ingredient ID: NPC162994

Ingredient ID: NPC15970

Ingredient ID: NPC157944

Ingredient ID: NPC15743

Ingredient ID: NPC154816

Ingredient ID: NPC152964

Ingredient ID: NPC148926

Ingredient ID: NPC147921

Ingredient ID: NPC147390

Ingredient ID: NPC14682

Ingredient ID: NPC141777

Ingredient ID: NPC13991

Ingredient ID: NPC139209

Ingredient ID: NPC135353

Ingredient ID: NPC13504

Ingredient ID: NPC131981

Ingredient ID: NPC131657

Ingredient ID: NPC126935

Ingredient ID: NPC126792

Ingredient ID: NPC126240

Ingredient ID: NPC124885

Ingredient ID: NPC123229

Ingredient ID: NPC12269

Ingredient ID: NPC120926

Ingredient ID: NPC116775

Ingredient ID: NPC116711

Ingredient ID: NPC114992

Ingredient ID: NPC114239

Ingredient ID: NPC114011

Ingredient ID: NPC108494

Ingredient ID: NPC103213

Ingredient ID: NPC100879

Ingredient ID: NPC100362