• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Portulaca Oleracea


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCATTGTCGAAACCTGCCCAGCAGAACGAGGGGGGACGAGTAAACATCACACGCGGCGAGGGGTGCTTCGGCCCCCTCCTCGTGCCGGGGGAGCCCCCCTCGTGGGGGTGCCCCCGGGGCAACAACGAACCCCGGCGCGGACTGCGCCAAGGAACACAAACTCATGGCGTGCCCGCCCGCGAACGGTTCGCCGGCGCGCGGGGGCGGCACCTGTCCCTACTTAAAACGTAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTTGCGCCCGAAGCCTTCTGGCTGAGGGCACGTCTGCCTGTTTTTTTTCGCTTCGCGTCTCCCCCCGCCCTCGTGGAGGGGGATGGATGATGGCCTCCCGTGCCCCGGTCGGGGCGCGGCTGGCCTAAAATCGGAGCCGACGACGACGAGCTGTTGTGGCGATTGGTGGTTGACGAGGCTTTAACGGCCTGTTTACATCGCGCCGCTGGAGCACGCTGTTGGGATGGGCTTGTTGGACCCATGGGTGGCTCAAGCCACGCAAAACCGTTGCGACC

Click for details-----ITS1

AGACATTGTCGAACCTGCCCAGCAGAACGACCTGTGGACGAGTAAACATCACACGCGGCGAGGGGTGCTTCGGCCCCCTCCTCGTGCCGGGGGAGCCCCCCTCGTGGGGGTGCCCCCGGGGCAACAACGAACCCCGGCGCGGACTGCGCCAAGGAACACAAACTCATGGCGTGCCCGCCCGCGAACGGTTCGCCGGCGCGCGGGGGCGGCACCTGTCCCTACTTAAAACGTAA

Click for details-----ITS2

TTCGCGTCTCCCCCCGCCCTCGTGGAGGGGGATGGAATGATGGCCTCCCGTGCCCCGGTCGGGGCGCGGTCTGGCCTAAAATCGGGAGCCGATGACGACGAGCTGTTGTGGCGATTGGTGGTTTGACGAGGCTTAACGGCCCTGTTTACATCGCGCCGGCTGGGAGCACGCTGTTGGATGGGCCTTGTTGGAACCCATGGG
Taxonomic Information

Plant ID: NPO4640
Plant Latin Name: Portulaca Oleracea
Taxonomy Genus: Portulaca
Taxonomy Family: Portulacaceae

Plant External Links:

NCBI TaxonomyDB: 46147
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Brazil; Turkey; Madagascar; Italy; Rwanda; Swaziland; Argentina; Burkina Faso; Ghana; Israel; Zimbabwe; Jordan; China; Philippines; Nigeria; Tanzania; Indonesia; Angola; Mexico; South Africa; India; Malaysia; Kenya

Traditional Medicine System:
Indian Folk; TCM; Unani; Ayurveda; Siddha


Medicinal Functions:

Antiscorbutic; Depurative; Diuretic; Febrifuge; Skin; Tonic; Vermifuge

Geographical Distribution

Brazil; Turkey; Madagascar; Italy; Rwanda; Swaziland; Argentina; Burkina Faso; Ghana; Israel; Zimbabwe; Jordan; China; Tanzania; Nigeria; Philippines; Indonesia; Angola; Mexico; South Africa; India; Malaysia; Kenya

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

225 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


136 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

152 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99724

Ingredient ID: NPC99305

Ingredient ID: NPC95885

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC92197

Ingredient ID: NPC91495

Ingredient ID: NPC90803

Ingredient ID: NPC90506

Ingredient ID: NPC89088

Ingredient ID: NPC88803

Ingredient ID: NPC87781

Ingredient ID: NPC85845

Ingredient ID: NPC85813

Ingredient ID: NPC8496

Ingredient ID: NPC82963

Ingredient ID: NPC81010

Ingredient ID: NPC79916

Ingredient ID: NPC79056

Ingredient ID: NPC70744

Ingredient ID: NPC67788

Ingredient ID: NPC66577

Ingredient ID: NPC62045

Ingredient ID: NPC61477

Ingredient ID: NPC60548

Ingredient ID: NPC5924

Ingredient ID: NPC57801

Ingredient ID: NPC56432

Ingredient ID: NPC55412

Ingredient ID: NPC53208

Ingredient ID: NPC51260

Ingredient ID: NPC50898

Ingredient ID: NPC50861

Ingredient ID: NPC50100

Ingredient ID: NPC491287

Ingredient ID: NPC489907

Ingredient ID: NPC485011

Ingredient ID: NPC485010

Ingredient ID: NPC485009

Ingredient ID: NPC485008

Ingredient ID: NPC485007

Ingredient ID: NPC485006

Ingredient ID: NPC485005

Ingredient ID: NPC485004

Ingredient ID: NPC485003

Ingredient ID: NPC485002

Ingredient ID: NPC485001

Ingredient ID: NPC485000

Ingredient ID: NPC484999

Ingredient ID: NPC484998

Ingredient ID: NPC484997

Ingredient ID: NPC484996

Ingredient ID: NPC484995

Ingredient ID: NPC484994

Ingredient ID: NPC484993

Ingredient ID: NPC484992

Ingredient ID: NPC484991

Ingredient ID: NPC484990

Ingredient ID: NPC484989

Ingredient ID: NPC484988

Ingredient ID: NPC484987

Ingredient ID: NPC484986

Ingredient ID: NPC484985

Ingredient ID: NPC484984

Ingredient ID: NPC484983

Ingredient ID: NPC484982

Ingredient ID: NPC484981

Ingredient ID: NPC484980

Ingredient ID: NPC484979

Ingredient ID: NPC483291

Ingredient ID: NPC44382

Ingredient ID: NPC44328

Ingredient ID: NPC43211

Ingredient ID: NPC42471

Ingredient ID: NPC424

Ingredient ID: NPC41385

Ingredient ID: NPC36108

Ingredient ID: NPC36061

Ingredient ID: NPC33707

Ingredient ID: NPC33666

Ingredient ID: NPC33338

Ingredient ID: NPC32977

Ingredient ID: NPC328447

Ingredient ID: NPC32222

Ingredient ID: NPC317120

Ingredient ID: NPC314120

Ingredient ID: NPC312132

Ingredient ID: NPC309606

Ingredient ID: NPC308749

Ingredient ID: NPC307063

Ingredient ID: NPC303045

Ingredient ID: NPC302857

Ingredient ID: NPC302453

Ingredient ID: NPC302171

Ingredient ID: NPC301585

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC292701

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC287349

Ingredient ID: NPC281972

Ingredient ID: NPC281686

Ingredient ID: NPC279121

Ingredient ID: NPC27794

Ingredient ID: NPC277736

Ingredient ID: NPC277174

Ingredient ID: NPC273963

Ingredient ID: NPC272614

Ingredient ID: NPC272113

Ingredient ID: NPC270329

Ingredient ID: NPC269919

Ingredient ID: NPC26974

Ingredient ID: NPC26928

Ingredient ID: NPC268342

Ingredient ID: NPC267210

Ingredient ID: NPC262968

Ingredient ID: NPC261831

Ingredient ID: NPC261619

Ingredient ID: NPC259767

Ingredient ID: NPC257435

Ingredient ID: NPC255514

Ingredient ID: NPC250828

Ingredient ID: NPC249815

Ingredient ID: NPC248903

Ingredient ID: NPC246469

Ingredient ID: NPC246358

Ingredient ID: NPC246026

Ingredient ID: NPC243728

Ingredient ID: NPC237812

Ingredient ID: NPC237435

Ingredient ID: NPC236347

Ingredient ID: NPC233731

Ingredient ID: NPC230301

Ingredient ID: NPC226453

Ingredient ID: NPC224227

Ingredient ID: NPC216630

Ingredient ID: NPC216394

Ingredient ID: NPC209846

Ingredient ID: NPC208793

Ingredient ID: NPC208075

Ingredient ID: NPC20791

Ingredient ID: NPC207824

Ingredient ID: NPC206589

Ingredient ID: NPC20460

Ingredient ID: NPC204376

Ingredient ID: NPC203468

Ingredient ID: NPC202600

Ingredient ID: NPC198778

Ingredient ID: NPC195749

Ingredient ID: NPC192638

Ingredient ID: NPC192402

Ingredient ID: NPC189142

Ingredient ID: NPC187770

Ingredient ID: NPC185755

Ingredient ID: NPC18335

Ingredient ID: NPC178134

Ingredient ID: NPC17810

Ingredient ID: NPC176740

Ingredient ID: NPC17624

Ingredient ID: NPC174304

Ingredient ID: NPC174246

Ingredient ID: NPC171139

Ingredient ID: NPC170475

Ingredient ID: NPC169749

Ingredient ID: NPC169207

Ingredient ID: NPC167400

Ingredient ID: NPC1656

Ingredient ID: NPC163755

Ingredient ID: NPC162822

Ingredient ID: NPC161972

Ingredient ID: NPC161774

Ingredient ID: NPC161593

Ingredient ID: NPC16031

Ingredient ID: NPC15970

Ingredient ID: NPC156353

Ingredient ID: NPC154858

Ingredient ID: NPC153958

Ingredient ID: NPC153556

Ingredient ID: NPC152912

Ingredient ID: NPC152538

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC148124

Ingredient ID: NPC147983

Ingredient ID: NPC146422

Ingredient ID: NPC146197

Ingredient ID: NPC145708

Ingredient ID: NPC142860

Ingredient ID: NPC142540

Ingredient ID: NPC141953

Ingredient ID: NPC141126

Ingredient ID: NPC141078

Ingredient ID: NPC139029

Ingredient ID: NPC138113

Ingredient ID: NPC137958

Ingredient ID: NPC137816

Ingredient ID: NPC136014

Ingredient ID: NPC13428

Ingredient ID: NPC130760

Ingredient ID: NPC128061

Ingredient ID: NPC126681

Ingredient ID: NPC125852

Ingredient ID: NPC125062

Ingredient ID: NPC124567

Ingredient ID: NPC12269

Ingredient ID: NPC119806

Ingredient ID: NPC118522

Ingredient ID: NPC117572

Ingredient ID: NPC116775

Ingredient ID: NPC115627

Ingredient ID: NPC11433

Ingredient ID: NPC113877

Ingredient ID: NPC112890

Ingredient ID: NPC112701

Ingredient ID: NPC111710

Ingredient ID: NPC110870

Ingredient ID: NPC110136

Ingredient ID: NPC109594

Ingredient ID: NPC1075

Ingredient ID: NPC104653

Ingredient ID: NPC1042

Ingredient ID: NPC102266

Ingredient ID: NPC101941

Ingredient ID: NPC100128