• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Alangium Ridleyi


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCCCAGCAGAACGACCCGTGAACACGTTAAACAACGCAGCGCGAGGGGCGGGCGTGCTCGCCTCCCGCGCATACAACGAACCCCGGCGCGAATCGCGCCAAGGATCACTCACAAAAAGCAGCCAACCCGGGCGCCCCGTTCGCGGGTGCGCCCGGGAACAAGTGGCTTCTTTCGCGAATCAAAACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCTACTAGGCCGAGGGCACGTCTGCCTGGGCGTCTCGCAACGCGTCGCCCCCCCCACCCGCCTCGCCAAGCGCTGCGGGTCTGGAAGGGGCGGATGGTGGCCTCCCGTGCGCGGATGTCGTGCGCGGCTGGCCCAAAAACGAGTCCCCGACGACGGGCGTCGCGACAAGTGGTGGTTGAGAGACCCTCGGTCCCCCGGTCGCGTCGTGTCGCGCGCATTGCCGTCGCCGGCGTGGAACTCAAGCAGTGACCCCAACGCACCCGCAAGGTGCCTCGACCGCGACCCCAGGTCAGGCG

Click for details-----ITS1

TCGAAACCTGCCCAGCAGAACGACCCGTGAACACGTTAAACAACGCAGCGCGAGGGGCGGGCGTGCTCGCCTCCCGCGCATACAACGAACCCCGGCGCGAATCGCGCCAAGGATCACTCACAAAAAGCAGCCAACCCGGGCGCCCCGTTCGCGGGTGCGCCCGGGAACAAGTGGCTTCTTTCGCGAATCAAAA

Click for details-----ITS2

AACGCGTCGCCCCCCCCACCCGCCTCGCCAAGCGCTGCGGGTCTGGAAGGGGCGGATGGTGGCCTCCCGTGCGCGGATGTCGTGCGCGGCTGGCCCAAAAACGAGTCCCCGACGACGGGCGTCGCGACAAGTGGTGGTTGAGAGACCCTCGGTCCCCCGGTCGCGTCGTGTCGCGCGCATTGCCGTCGCCGGCGTGGAACTCAAGCAGTGACCCCAACGCACCCGCAAGGTGCCTCGACCGCGACCCCAGGTCAGGCG
Taxonomic Information

Plant ID: NPO460
Plant Latin Name: Alangium Ridleyi
Taxonomy Genus: Alangium
Taxonomy Family: Cornaceae

Plant External Links:

NCBI TaxonomyDB: 616983
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available
Compounds Summary

Overview of Ingredients

20 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


11 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

9 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.





Ingredient Structrual Cards

Ingredient ID: NPC92898

Ingredient ID: NPC83938

Ingredient ID: NPC71074

Ingredient ID: NPC65905

Ingredient ID: NPC50898

Ingredient ID: NPC307176

Ingredient ID: NPC304309

Ingredient ID: NPC301589

Ingredient ID: NPC300351

Ingredient ID: NPC289112

Ingredient ID: NPC284172

Ingredient ID: NPC282188

Ingredient ID: NPC270383

Ingredient ID: NPC263049

Ingredient ID: NPC231772

Ingredient ID: NPC228834

Ingredient ID: NPC222898

Ingredient ID: NPC22140

Ingredient ID: NPC189142

Ingredient ID: NPC140255

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target Type Protein Class Gene ID Protein Name Uniprot ID Target ChEMBL ID
Cytochrome P450 Cytochrome P450 family 1 CYP1A2 Cytochrome P450 1A2 P05177 CHEMBL3356
Cytochrome P450 Cytochrome P450 family 1 CYP1B1 Cytochrome P450 1B1 Q16678 CHEMBL4878
Cytochrome P450 Cytochrome P450 family 1 CYP1A1 Cytochrome P450 1A1 P04798 CHEMBL2231
Therapeutic Target Hydrolase ACHE Acetylcholinesterase P22303 CHEMBL220
Therapeutic Target Nuclear hormone receptor subfamily 3 PGR Progesterone receptor P06401 CHEMBL208
Therapeutic Target Nuclear hormone receptor subfamily 3 AR Androgen Receptor P10275 CHEMBL1871
Therapeutic Target Nuclear hormone receptor subfamily 3 NR3C2 Mineralocorticoid receptor P08235 CHEMBL1994
Therapeutic Target Nuclear hormone receptor subfamily 3 ESR2 Estrogen receptor beta Q92731 CHEMBL242
Therapeutic Target Nuclear hormone receptor subfamily 3 NR3C1 Glucocorticoid receptor P04150 CHEMBL2034
Therapeutic Target Oxidoreductase MAOB Monoamine oxidase B P27338 CHEMBL2039
Therapeutic Target Oxidoreductase MAOA Monoamine oxidase A P21397 CHEMBL1951
Therapeutic Target Oxidoreductase HSD11B1 11-beta-hydroxysteroid dehydrogenase 1 P28845 CHEMBL4235
Therapeutic Target Oxidoreductase HSD17B1 Estradiol 17-beta-dehydrogenase 1 P14061 CHEMBL3181
Therapeutic Target Protein Kinase CDK8 Cell division protein kinase 8 P49336 CHEMBL5719
Therapeutic Target Protein Kinase CSNK2A1 Casein kinase II alpha P68400 CHEMBL3629
Therapeutic Target Protein Kinase MKNK2 MAP kinase signal-integrating kinase 2 Q9HBH9 CHEMBL4204
Therapeutic Target Secreted protein SERPINA6 Corticosteroid binding globulin P08185 CHEMBL2421
Therapeutic Target Secreted protein TTR Transthyretin P02766 CHEMBL3194
Therapeutic Target Secreted protein THPO Thrombopoietin P40225 CHEMBL1293256
Therapeutic Target Serine protease DPP4 Dipeptidyl peptidase IV P27487 CHEMBL284
Therapeutic Target Transcription factor HIF1A Hypoxia-inducible factor 1 alpha Q16665 CHEMBL4261
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
NP level105
Clinical trial details
NCT ID Title Condition Form in clinical use Associated by plant or compound
NCT00123669 Primary Progesterone Therapy for Operable Breast Cancer breast neoplasm Progesterone (NPC307176) NP level
NCT00000466 Postmenopausal Estrogen/Progestin Interventions (PEPI) diabetes mellitus;Hypercholesterolemia;hypertension;menopause;Myocardial Ischemia;osteoporosis;thrombotic disease Progesterone (NPC307176) NP level
NCT01143064 Efficacy and Safety Study of Intravenous Progesterone in Patients With Severe Traumatic Brain Injury brain injury Progesterone (NPC307176) NP level
NCT02145767 Progesterone for the Prevention of Miscarriage and Preterm Birth in Women With First Trimester Bleeding: PREEMPT Trial premature birth Progesterone (NPC307176) NP level
NCT01972464 Progesterone for Smoking Relapse Prevention Following Delivery nicotine dependence Progesterone (NPC307176) NP level
NCT00088153 Effects of Anorexia Nervosa on Bone Mass in Adolescents anorexia nervosa Progesterone (NPC307176) NP level
NCT03071172 Clinical Study of Recombinant Human Follitropin for Injection Assisted in COH Assisted IVF-ET ovarian hyperstimulation syndrome Progesterone (NPC307176) NP level
NCT00048646 Progesterone Treatment of Blunt Traumatic Brain Injury brain injury Progesterone (NPC307176) NP level
NCT05091866 Natural Progesterone for the Treatment of Recurrent Glioblastoma gliosarcoma Progesterone (NPC307176) NP level
NCT02118051 Effect of Treatment With Corifollitropin Alpha in Vitro Fertilization in Patients With Poor Ovarian Response. infertility Progesterone (NPC307176) NP level
NCT04046185 Programmed Death-1(PD-1) Inhibitor Combined With Progesterone Treatment in Endometrial Cancer endometrial cancer Progesterone (NPC307176) NP level
NCT02470676 Cervical Pessary vs Vaginal Progesterone in Preventing Preterm Birth Among Women Presenting With Short Cervix: An Open-label Randomized Controlled Trial premature birth Progesterone (NPC307176) NP level
NCT00480402 Natural Progesterone and Preterm Birth in Twins premature birth Progesterone (NPC307176) NP level
NCT03633175 Progesterone in Patients With Placenta Previa placenta praevia Progesterone (NPC307176) NP level
NCT01180296 Oral Progesterone for Prevention of Preterm Birth premature birth Progesterone (NPC307176) NP level
NCT02510534 Effect of Luteal Progesterone Support on Pregnancy Rates With Combined Clomid/ Gonadotropin & IUI pregnancy Progesterone (NPC307176) NP level
NCT01811225 Smoking, Sex Hormones, and Pregnancy nicotine dependence Progesterone (NPC307176) NP level
NCT01081652 A Study Using Micronised Progesterone (Crinone® 8%) in the Luteal Phase Support of Women Undergoing in Vitro Fertilisation (IVF) and Embryo Transfer (ET) infertility Progesterone (NPC307176) NP level
NCT00006399 Effects of Estrogen on Memory in Post-Menopausal Women and Patients With Alzheimer's Disease Alzheimer disease Progesterone (NPC307176) NP level
NCT01074892 A Study Comparing Mirena and Systemic Progestin for Endometrial Hyperplasia endometrial hyperplasia Progesterone (NPC307176) NP level
NCT01796522 Utility of Tocolytic Therapy for Maintenance Tocolysis in the Management of Threatened Preterm Delivery premature birth Progesterone (NPC307176) NP level
NCT04753957 Pharmacokinetics of Progesterone in Pregnancy-2 pregnancy Progesterone (NPC307176) NP level
NCT05365464 HOPE Trial hCG or Progesterone Effect on Recurrent Pregnancy Loss pregnancy Progesterone (NPC307176) NP level
NCT01126255 Progesterone vs Clobetasol Propionate in Vulvar Lichen Sclerosus Vulvar Lichen Sclerosus Progesterone (NPC307176) NP level
NCT05244811 Treat of Functional Ovarian Cysts by Compare Between Cocs and Progesterone Only Pills ovarian neoplasm Progesterone (NPC307176) NP level
NCT00029536 Progesterone vs Placebo Therapy for Women With Epilepsy epilepsy Progesterone (NPC307176) NP level
NCT03729869 Impact of Progesterone on Stress Reactivity and Cannabis Use cannabis dependence Progesterone (NPC307176) NP level
NCT02467673 Nanoparticulate Versus Micronized Steroids Delivery for Transdermal Hormone Replacement Therapy menopause Progesterone (NPC307176) NP level
NCT01265017 Role of Pregnancy Related Hormones in Lowering the Insulin Requirement in Pregnant Women With Type 1 Diabetes type 1 diabetes mellitus Progesterone (NPC307176) NP level
NCT02019589 A Phase 3, Randomized, Three-Cycle, Double-Blind, Placebo-Controlled Study to Evaluate Induction of Secretory Conversion of Endometrium and Withdrawal Bleeding for Secondary Amenorrhea amenorrhea Progesterone (NPC307176) NP level
NCT00615550 PREGNANT Short Cervix Trial premature birth Progesterone (NPC307176) NP level
NCT03077698 An Endometrial Cancer Study for Women With Recurrent or Persistent Endometrial Cancer endometrial cancer Progesterone (NPC307176) NP level
NCT00577122 Medroxyprogesterone +/- Cyclophosphamide & Methotrexate in Hormone Receptor-Negative Recurrent/Metastatic Breast Cancer breast cancer Progesterone (NPC307176) NP level
NCT04865029 Estradiol and Progesterone in Hospitalized COVID-19 Patients COVID-19 Progesterone (NPC307176) NP level
NCT00271206 Effect of Progesterone on Smoking Behavior in Male and Female Smokers nicotine dependence Progesterone (NPC307176) NP level
NCT03430050 Progesterone for Cannabis Withdrawal cannabis dependence Progesterone (NPC307176) NP level
NCT02350231 Progesterone Vaginal Pessary for Prevention of Preterm Twin Birth premature birth Progesterone (NPC307176) NP level
NCT00000601 Postmenopausal Hormone Therapy in Unstable Angina intermediate coronary syndrome;menopause Progesterone (NPC307176) NP level
NCT02400021 Progesterone Supplementation for HIV-positive Pregnant Women on Anti-Retrovirals HIV-1 infection Progesterone (NPC307176) NP level
NCT01293747 Pharmacokinetics of Injectable Estradiol and Progesterone Microspheres Suspension menopause Progesterone (NPC307176) NP level
NCT01147770 Prolongation of Progesterone Supplementation in Antagonist Cycles and Pregnancy Outcomes infertility Progesterone (NPC307176) NP level
NCT01985594 Utrogestan Versus Nifedipine as Tocolysis for Preterm Labor: a Randomised Controlled Trial premature birth Progesterone (NPC307176) NP level
NCT02304237 Vaginal Compared With Intramuscular Progesterone for Prevention of Preterm Birth in High Risk Pregnant Women premature birth Progesterone (NPC307176) NP level
NCT00247169 Vaginal Progesterone in the Treatment of Cervical Dysplasia Grade I and II cervical intraepithelial neoplasia Progesterone (NPC307176) NP level
NCT01941875 Luteal Phase Progesterone in IUI and Gonadotropin Cycles infertility Progesterone (NPC307176) NP level
NCT00000295 Progesterone Treatment in Female Smokers - 12 nicotine dependence Progesterone (NPC307176) NP level
NCT00086177 Vaginal Progesterone to Reduce the Risk of Another Preterm Birth pregnancy Progesterone (NPC307176) NP level
NCT03537287 Different Types of Progesterone in the Prevention of Preterm Labor premature birth Progesterone (NPC307176) NP level
NCT00828191 Subcutaneous Progesterone Versus Vaginal Progesterone Tablets for Luteal Phase Support in In Vitro Fertilization (IVF) infertility Progesterone (NPC307176) NP level
NCT01057511 Compare the Difference of P4 Concentration in Serum and Endometrium After Vaginal and IM P Administration menopause Progesterone (NPC307176) NP level
NCT00001481 The Role of Hormones in Postpartum Mood Disorders postpartum depression Progesterone (NPC307176) NP level
NCT03701490 Prolutex in Frozen Embryo Transfer Cycles at the Blastocyst Stage (PROGEX) infertility Progesterone (NPC307176) NP level
NCT00632099 Progesterone Treatment for Cocaine-dependent Women: A Pilot Study cocaine dependence Progesterone (NPC307176) NP level
NCT02224313 Effect of Oral Estradiol and Progesterone Therapy on Vaginal Cytokines in Postmenopausal Women menopause Progesterone (NPC307176) NP level
NCT02225353 Efficacy Study of a Cervical Pessary Containing Progesterone for the Prevention of Preterm Delivery premature birth Progesterone (NPC307176) NP level
NCT04342585 Comparison Between Vaginal Pessary and Progestogen in Twin Pregnancy With Short Cervical Length premature birth Progesterone (NPC307176) NP level
NCT00083824 Estrogen, HDL, and Coronary Heart Disease in Women coronary artery disease Progesterone (NPC307176) NP level
NCT01252069 PGL4001 Efficacy Assessment in Reduction of Symptoms Due to Uterine Leiomyomata (PEARLIII-extension Study) uterine fibroid Progesterone (NPC307176) NP level
NCT02736032 Cryopreserved-thawed Embryo Transfer With or Without Gonadotropin Releasing Hormone Agonist infertility Progesterone (NPC307176) NP level
NCT00775242 Efficacy and Safety of Estradiol and Progesterone Microspheres for the Treatment of Climacteric Symptoms. menopause Progesterone (NPC307176) NP level
NCT05128071 PRevention Of Methamphetamine Use Among Postpartum Women Trial (PROMPT) methamphetamine dependence Progesterone (NPC307176) NP level
NCT04225221 Neurobiology of Bulimia Nervosa bulimia nervosa Progesterone (NPC307176) NP level
NCT01608451 Randomized Controlled Trial of Neo-adjuvant Progesterone and Vitamin D3 in Women With Large Operable Breast Cancer and Locally Advanced Breast Cancer breast cancer Progesterone (NPC307176) NP level
NCT00594217 Determining How Quickly Progesterone Slows LH Pulse Frequency polycystic ovary syndrome Progesterone (NPC307176) NP level
NCT00000176 Alzheimer's Disease Prevention Trial Alzheimer disease;memory impairment Progesterone (NPC307176) NP level
NCT00696800 A Study to Investigate the Efficacy and Safety of a Single Injection of Corifollitropin Alfa (Organon 36286) for Ovarian Stimulation Using Daily Recombinant Follicle Stimulating Hormone (FSH) as Reference (P05787) infertility Progesterone (NPC307176) NP level
NCT00822900 Progesterone for the Treatment of Traumatic Brain Injury III brain injury Progesterone (NPC307176) NP level
NCT00329914 Does Progesterone Prevent Very Preterm Delivery in Twin Pregnancies? premature birth Progesterone (NPC307176) NP level
NCT00615251 A Clinical Trial to Evaluate the Efficacy and Safety of DR-2011 for In Vitro Fertilization infertility Progesterone (NPC307176) NP level
NCT01850030 A Multicenter Study Comparing the Efficacy, Safety and Tolerability of Oral Dydrogesterone 30 mg Daily Versus Intravaginal Micronized Progesterone Capsules 600 mg Daily for Luteal Support in In-Vitro Fertilization female infertility Progesterone (NPC307176) NP level
NCT04549116 Subcutaneous Progesterone in Frozen- Thawed Single Euploid Blastocyst Transfer. infertility Progesterone (NPC307176) NP level
NCT04051320 Characterizing the Neural Substrates of Irritability in Women: an Experimental Neuroendocrine Model postpartum depression Progesterone (NPC307176) NP level
NCT00827983 Subcutaneous Progesterone Versus Vaginal Progesterone Gel for Luteal Phase Support in Patients Undergoing In-Vitro Fertilization (IVF) infertility Progesterone (NPC307176) NP level
NCT03774745 Blocking Mifepristone Action With Progesterone pregnancy Progesterone (NPC307176) NP level
NCT00928213 PP13 and Doppler Study to Predict Preeclampsia preeclampsia Progesterone (NPC307176) NP level
NCT00000430 Low-Dose Hormone Replacement Therapy and Alendronate for Osteoporosis Osteopenia;osteoporosis Progesterone (NPC307176) NP level
NCT00702845 To Investigate Efficacy and Safety of a Single Injection of Org 36286 for Ovarian Stimulation Using Daily Recombinant FSH as Reference (Ensure)(P05690/MK-8962-001) infertility Progesterone (NPC307176) NP level
NCT01153581 Sex Hormones and Orthostatic Tolerance orthostatic intolerance Progesterone (NPC307176) NP level
NCT00000555 Women's Angiographic Vitamin and Estrogen Trial (WAVE) menopause;Myocardial Ischemia Progesterone (NPC307176) NP level
NCT04597099 Androgen Blockade and Progesterone Augmentation of Gonadotropin Secretion polycystic ovary syndrome Progesterone (NPC307176) NP level
NCT04537078 Progestin Primed Double Stimulation Protocol Versus Flexible GnRH Antagonist Protocol in Poor Responders infertility Progesterone (NPC307176) NP level
NCT02491437 A Study Comparing the Efficacy, Safety and Tolerability of Oral Dydrogesterone 30 mg Daily Versus Crinone 8% Intravaginal Progesterone Gel 90 mg Daily for Luteal Support in In-Vitro Fertilization (LOTUS II) female infertility Progesterone (NPC307176) NP level
NCT01812239 Vaginal Progesterone in Twins With Short Cervix premature birth Progesterone (NPC307176) NP level
NCT02989519 Efficacy of Oral Progesterone and Vaginal Progesterone After Tocolytic Therapy in Threatened Preterm Labor premature birth Progesterone (NPC307176) NP level
NCT01599494 An Efficacy and Safety Study of Corifollitropin Alfa (MK-8962) in Contrast to Recombinant FSH for Use in Controlled Ovarian Stimulation of Indian Women (P07056, Also Known as MK-8962-029) infertility Progesterone (NPC307176) NP level
NCT03202186 Study of Progesterone in Treatment of Vasomotor Symptoms menopause Progesterone (NPC307176) NP level
NCT00946192 Fat Mediated Modulation of Reproductive and Endocrine Function in Young Athletes amenorrhea Progesterone (NPC307176) NP level
NCT00302731 Bioidentical 'Natural' Hormone Evaluation in Early Menopause menopause Progesterone (NPC307176) NP level
NCT00696878 Corifollitropin Alfa in Participants Undergoing Repeated Controlled Ovarian Stimulation (COS) Cycles Using a Multiple Dose Gonadatropin Releasing Hormone (GnRH) Antagonist Protocol (Study 38825)(P05714) infertility Progesterone (NPC307176) NP level
NCT00455962 Effect of Race on Gonadotropin Responses menopause Progesterone (NPC307176) NP level
NCT01156857 PGL4001 Efficacy Assessment in Reduction of Symptoms Due to Uterine Leiomyomata uterine fibroid Progesterone (NPC307176) NP level
NCT00946088 Progesterone for Maintenance Tocolysis: A Randomized Placebo Controlled Trial pregnancy Progesterone (NPC307176) NP level
NCT03152942 Progesterone and Aminophylline for the Prevention of Preterm Labour premature birth Progesterone (NPC307176) NP level
NCT01178788 Progestagens for the Tertiary Prophylaxis of Preterm Delivery premature birth Progesterone (NPC307176) NP level
NCT02697331 Vaginal Progesterone in Twin With Short Cervix premature birth Progesterone (NPC307176) NP level
NCT01942668 A Safety and Efficacy Study of the Combination Estradiol and Progesterone to Treat Vasomotor Symptoms menopause Progesterone (NPC307176) NP level
NCT00809939 17 Alfa Hydroxyprogesterone Caproate Versus Natural Progesterone for the Prevention of Preterm Labor pregnancy Progesterone (NPC307176) NP level
NCT01176175 Progesterone Microspheres Pharmacokinetic - Pharmacodynamic (PK-PD) Study infertility Progesterone (NPC307176) NP level
NCT04209543 Estetrol for the Treatment of Moderate to Severe Vasomotor Symptoms in Postmenopausal Women (E4Comfort Study I) menopause Progesterone (NPC307176) NP level
NCT04365127 Progesterone for the Treatment of COVID-19 in Hospitalized Men COVID-19 Progesterone (NPC307176) NP level
NCT03440359 Vaginal Progesterone Supplementation in Women With PCOS Undergoing Ovulation Induction With Letrozole polycystic ovary syndrome Progesterone (NPC307176) NP level
NCT02841137 Efficacy Study of Progesterone Tablet in Post-menopausal Women menopause Progesterone (NPC307176) NP level
NCT00117468 Comparison of DR-2011 to a Progesterone Vaginal Gel for Luteal Phase Replacement infertility Progesterone (NPC307176) NP level
NCT04938011 A Randomized Controlled Study of Prolonging the Time of Progesterone Supplementation to Improve the Pregnancy Outcome of Single Day 6 Blastocyst Transfer of Freeze-thaw Cycle infertility Progesterone (NPC307176) NP level
NCT00585520 Sex Differences in Progesterone Effects on Responses to Stress and Drug Cues cocaine dependence Progesterone (NPC307176) NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
 ❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Breast cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C60-2C6Y
 CYP19A1,PGR,ESR2,AR,MKNK2,NR3C1
 NCT01608451,NCT00577122
Alzheimer disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A20
 SIGMAR1,MAOB,ESR2,HSD11B1,MAOA,ACHE
 NCT00000176,NCT00006399
Pregnancy/childbirth/puerperium maternal infection
Disease Category: 18.Pregnancy, childbirth or the puerperium
Disease ICD-11 Code: JB63
 NCT03774745,NCT00946088,NCT00086177,NCT00809939,NCT04753957,NCT05365464,NCT02510534
Solid tumour/cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00-2F9Z
 HIF1A,PGR,CSNK2A1,MKNK2,XDH,NR3C1
Serous cystadenoma,borderline malignancy of ovary
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73.4
 CSNK2A3,XDH,CSNK2A1,CYP1A2,SIGMAR1,PSMB5
Cytomegaloviral disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D82
 THPO,ESR2,PGR,ACHE,CYP1A1,CYP2C19
Germ cell tumour of testis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C80.2
 XDH,HIF1A,TTR,DPP4,ACHE,SERPINA6
Prostate cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82
 ESR2,MAOA,AR,MAOB,NR3C1
Carcinosarcoma of uterus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.43
 XDH,DPP4,SERPINA6,CYP19A1,PSMB5
Glioblastoma of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.00
 AR,CSNK2A3,CYP1B1,DPP4,CYP19A1
Depression
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A70-6A7Z
 SIGMAR1,NR3C1,MAOB,MAOA
Pulmonary hypertension
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BB01
 MAOB,HIF1A,NR3C2
 NCT00000466
Type 2 diabetes mellitus
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A11
 NR3C1,DPP4,NR3C2,HSD11B1
Parkinsonism
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A00
 SIGMAR1,MAOB,MAOA,ACHE
Nicotine use disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C4A
 NCT01811225,NCT00000295,NCT00271206,NCT01972464
Polycystic ovary syndrome
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A80.1
 CDK8
 NCT03440359,NCT04597099,NCT00594217
Pheochromocytoma
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH3854
 XDH,NR3C1,ACHE,TTR
Malignant neoplasms of biliary tract, distal bile duct
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C15
 CSNK2A3,CSNK2A1,ESR2,HIF1A
Mesothelioma of pleura
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C26.0
 XDH,DPP4,SIGMAR1,CSNK2A2
Urothelial carcinoma of bladder
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94.2
 CYP1A2,TTR,HSD17B1,SERPINA6
Adenocarcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.0
 THPO,XDH,TTR,ACHE
Malignant neoplasms of thymus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C27
 CYP1B1,DPP4,ACHE,PSMB5
Renal cell carcinoma, chromophobe type
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH6153
 PGR,CYP1A2,TTR,CYP1A1
Carpal tunnel syndrome
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C10.0
 CYP1B1,THPO,DPP4,HSD11B1
Malignant neoplasms of adrenal gland
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D11
 AR,NR3C1,DPP4,CYP19A1
Endometrial cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76
 PGR
 NCT03077698,NCT04046185
Heart failure
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD10-BD1Z
 NR3C2,XDH,AR
Muscular dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C70
 NR3C1,MAOB,AR
Chronic kidney disease
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GB61
 XDH,AR,NR3C2
Acute diabete complication
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A2Y
 HSD11B1,DPP4,NR3C1
Uterine fibroid
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2E86
 PGR
 NCT01156857,NCT01252069
Mood disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A60-6E23
 MAOA,SIGMAR1,NR3C1
Cushing syndrome
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A70
 CYP19A1,ESR2,NR3C1
Chronic obstructive pulmonary disease
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA22
 AR,SIGMAR1,NR3C1
Substance abuse
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C40
 NR3C1,ACHE,MAOA
Intracranial injury, unspecified
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: NA07.Z
 NCT01143064,NCT00822900,NCT00048646
Other specified malignant neoplasms of kidney, except renal pelvis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90.Y
 XDH,ACHE,CYP19A1
West Nile virus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D46
 DPP4,CYP19A1,ACHE
Superficial ovarian endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10.B4
 HSD17B1,DPP4,ACHE
Malignant neoplasms of thyroid gland, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D10.Z
 CYP1B1,XDH,DPP4
Chikungunya virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D40
 XDH,HIF1A,CYP19A1
Cardiovascular disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA00-BE2Z
 AR,NR3C2
Skin tag/polyp
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EK71
 MAOA,MAOB
Hyper-lipoproteinaemia
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C80
 HSD11B1,ESR2
Myasthenia gravis
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C6Y
 HSD11B1,ACHE
Influenza
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1E30-1E32
 HSD11B1,XDH
Liver cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12
 MKNK2,CSNK2A1
Indeterminate colitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD72
 NR3C1,ESR2
Vasomotor/allergic rhinitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA08
 ESR2,NR3C1
Myocardial infarction
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA41-BA43
 DPP4,THPO
Glaucoma
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9C61
 ACHE,HSD11B1
General pain disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8E43
 MAOA,MAOB
Mild neurocognitive disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6D71
 SIGMAR1,ACHE
Acute myeloid leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A60
 CDK8,AR
Postoperative inflammation
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A00-CA43
 NR3C1,SERPINA6
Metabolic disorder
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C50-5D2Z
 DPP4,HSD11B1
Hypo-osmolality/hyponatraemia
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C72
 NR3C2,AR
Dementia
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6D80-6D8Z
 ACHE,MAOB
Pain, unspecified
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG3Z
 SIGMAR1,ACHE
Atopic eczema
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA80
 NR3C1,NR3C1
Asthma
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA23
 NR3C1,SERPINA6
Female pelvic pain
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA34
 PGR,AR
Bulimia nervosa
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6B81
 SIGMAR1
 NCT04225221
Acquired hypomelanotic disorder
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED63
 MAOB,MAOA
Oesophagitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA24
 NR3C1,CYP19A1
Endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10
 PGR,CYP19A1
Diabetes mellitus, type unspecified
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A14
 DPP4
 NCT00000466
Retinopathy
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9B71
 NR3C1,SERPINA6
Mature T-cell lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A90
 MKNK2,HIF1A
Prostate hyperplasia
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA90
 AR,ESR2
Cocaine use disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C45
 NCT00632099,NCT00585520
Cannabis use disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C41
 NCT03430050,NCT03729869
Osteoporosis
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FB83.1
 NCT00000466,NCT00000430
Ischaemic heart diseases, unspecified
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA6Z
 NCT00000466,NCT00000555
COVID-19
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D6Y
 NCT04865029,NCT04365127
Mental or behavioural disorders associated with pregnancy, childbirth or the puerperium, without psychotic symptoms
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6E20
 NCT00001481,NCT04051320
Amenorrhoea
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA20.0
 NCT00946192,NCT02019589
Female infertility
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA31
 NCT02491437,NCT01850030
Hepatoblastoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.01
 PGR,CYP19A1
Adenocarcinoma of stomach
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72.0
 SERPINA6,CYP19A1
Squamous cell carcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.2
 XDH,HSD17B1
Hepatocellular carcinoma of liver
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.02
 CYP19A1,CYP19A1
Other specified malignant neoplasms of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.Y
 HSD17B1,XDH
Adenocarcinoma of prostate
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82.0
 TTR,SERPINA6
Systemic lupus erythematosus
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40.0
 CYP1A1,ACHE
Malignant neoplasms of corpus uteri, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.Z
 XDH,CYP1A1
Invasive carcinoma of breast
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C61
 THPO,SERPINA6
Preterm newborn, unspecified
Disease Category: 19.Certain conditions originating in the perinatal period
Disease ICD-11 Code: KA21.4Z
 NCT01812239,NCT00329914,NCT02989519,NCT00480402,NCT03152942,NCT00615550,NCT02225353,NCT01180296,NCT03537287,NCT02145767,NCT01985594,NCT01178788,NCT02697331,NCT02350231,NCT04342585,NCT02470676,NCT01796522,NCT02304237
Male infertility
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GB04
 NCT00827983,NCT02736032,NCT00696878,NCT00696800,NCT00117468,NCT00828191,NCT01941875,NCT01599494,NCT04549116,NCT03701490,NCT04537078,NCT00702845,NCT01147770,NCT02118051,NCT01176175,NCT04938011,NCT01081652,NCT00615251
Menopause
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA30.0
 NCT02841137,NCT00455962,NCT00000601,NCT00302731,NCT04209543,NCT01057511,NCT01942668,NCT02224313,NCT01293747,NCT00775242,NCT00000555,NCT03202186,NCT02467673,NCT00000466
Diffuse large B-cell lymphomas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 AR,THPO,CSNK2A1,ESR2,CDK8,MAOB,HSD11B1,ACHE,SIGMAR1,PSMB5,CSNK2A2
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 CYP1B1,XDH,PGR,MAOB,HIF1A,HSD11B1,TTR,DPP4,ACHE,CYP2C19
Obesity
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B80-5B81
 HSD11B1
Inborn lipid metabolism error
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C52
 HSD11B1
Coronavirus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D92
 CSNK2A1
Oesophageal/gastroduodenal disorder
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD90
 ACHE
Alopecia
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED70
 AR
Nausea/vomiting
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MD90
 MAOB
Otitis externa
Disease Category: 10.Diseases of the ear or mastoid process
Disease ICD-11 Code: AA00-AA13
 NR3C1
Spine/trunk injury
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: ND51
 NR3C1
Pituitary gland disorder
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A60-5A61
 AR
Alcoholic liver disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB94
 AR
Menopausal disorder
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA30
 ESR2
Colorectal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B91
 MKNK2
Chronic arterial occlusive disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD4Z
 DPP4
Primary psychotic disorder manifestation
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A25
 MAOB
Encephalopathy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8E47
 XDH
Preterm labour/delivery
Disease Category: 18.Pregnancy, childbirth or the puerperium
Disease ICD-11 Code: JB00
 PGR
Schizophrenia
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A20
 SIGMAR1
Immune system disease
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A01-4B41
 SIGMAR1
Malignant haematopoietic neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B33
 DPP4
Mineral deficiency
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B5K
 XDH
Intellectual development disorder
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LD90
 SIGMAR1
Mammary tumour
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C60-2C6Z
 AR
Psychotic disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A20-6A25
 SIGMAR1
Brain cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00
 HIF1A
Amyloidosis
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5D00
 TTR
Hepatitis virus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1E50-1E51
 ESR2
Allergic/hypersensitivity disorder
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A80-4A8Z
 NR3C1
Thrombosis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB61-GB90
 AR
Sexual dysfunction
Disease Category: 17.Conditions related to sexual health
Disease ICD-11 Code: HA00-HA01
 SIGMAR1
Unspecific substance harmful effect
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: NE6Z
 ACHE
Lupus erythematosus
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40
 HSD11B1
Ischaemic/haemorrhagic stroke
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B20
 THPO
Cataract
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9B10
 SIGMAR1
Acne vulgaris
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED80
 AR
Autism spectrum disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A02
 DPP4
Respiratory system disease
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CB40-CB7Z
 SERPINA6
Gout
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA25
 XDH
Cardiomyopathy
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BC43
 TTR
Adrenocortical insufficiency
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A74
 NR3C2
Epileptic encephalopathy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A62
 SIGMAR1
Muscle disorder
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FB32-FB3Z
 AR
Menstrual cycle bleeding disorder
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA20
 PGR
Testicular dysfunction
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A81
 AR
Low bone mass disorder
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FB83
 AR
Somnolence
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG42
 SIGMAR1
Neurobehavioral disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A00-8A0Z
 SIGMAR1
Cough
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MD12
 SIGMAR1
Neuropathy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C0Z
 CYP19A1
Vitamin deficiency
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B55-5B5F
 NR3C1
Adrenogenital disorder
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A71
 NR3C1
Psoriasis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA90
 DPP4
Migraine
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A80
 MAOB
Adrenomedullary hyperfunction
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A75
 HIF1A
Inborn purine/pyrimidine/nucleotide metabolism error
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C55
 XDH
Adaptive immunity immunodeficiency
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A01
 NR3C1
Skin cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30-2C37
 MAOB
Sepsis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1G40-1G41
 ESR2
Multiple sclerosis
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A40
 NR3C1
Parasitic worm infestation
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F90
 ACHE
Cystic fibrosis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA25
 SIGMAR1
Herpes simplex infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F00
 NR3C1
Rheumatoid arthritis
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA20
 NR3C1
Myelodysplastic syndrome
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A37
 CDK8
Central nervous system disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A04-8D87
 SIGMAR1
Malaria
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F40-1F45
 MAOB
Pediculosis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1G00
 ACHE
Age-associated cognitive decline
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MB21.0
 NCT00000176
Type1diabetesmellitus
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A10
 NCT01265017
Stimulant dependence including amphetamines, methamphetamine or methcathinone
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C46.2
 NCT05128071
Gliosarcoma
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH9RC8
 NCT05091866
Lichen sclerosus of vulva
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EB60.0
 NCT01126255
Pre-eclampsia
Disease Category: 18.Pregnancy, childbirth or the puerperium
Disease ICD-11 Code: JA24
 NCT00928213
Epilepsy/seizure
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A61-8A6Z
 NCT00029536
Osteopenia
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FB83.0
 NCT00000430
Cervical intraepithelial neoplasia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2E66
 NCT00247169
Malignant neoplasms of ovary
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73
 NCT05244811
Anorexia nervosa
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6B80
 NCT00088153
coronary artery disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA8Y-BA8Z
 NCT00083824
Human immunodeficiency virus type 1
Disease Category: X.Extension Codes
Disease ICD-11 Code: XN8LD
 NCT02400021
Deep vein thrombosis
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD71
 NCT00000466
Placenta praevia specified as without haemorrhage
Disease Category: 18.Pregnancy, childbirth or the puerperium
Disease ICD-11 Code: JA8B.0
 NCT03633175
NA
Disease Category: NA
Disease ICD-11 Code: NA
 NCT01153581
Neoplasms of unknown behaviour of breast
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2F95
 NCT00123669
Endometrial glandular hyperplasia
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA16.0
 NCT01074892
Unstable angina
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA40.0
 NCT00000601
Hypercholesterolaemia
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C80.0
 NCT00000466
Ovarian hyperstimulation syndrome
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA32.0
 NCT03071172
Crohn disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD70
 HSD11B1
Coeliac disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA95
 CYP1A1
Inflammatory bowel diseases, unspecified
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD7Z
 HSD11B1
Zika virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D48
 ACHE
Dengue fever, unspecified
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D2Z
 MAOA
Leishmaniasis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F54
 DPP4
Myotonic dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C71.0
 CYP1A1
Other specified malignant neoplasms ofcolon
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B90.Y
 CYP1A1
Melanoma of skin
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30
 TTR
Pneumonia due to Pseudomonasaeruginosa
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA40.05
 DPP4
Malignant neoplasms of oesophagus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B70
 ACHE
Chronic rhinosinusitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA0A
 CYP1A1
Heart failure, unspecified
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD1Z
 CYP1B1
Ebola virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D60.01
 ACHE

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group