• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Isatis Tinctoria


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGATACCTTATCGTAAACAGAACGACCCGCGAACGATTGATCATCACTCTCGGTGGGCTGGTGTCTTAGCTGATTCCGTGCCTGCCGATTCCGTGGTTATGCGCGTGGTCTCAGCCAAGATTCATATCTCGGTTGGGTCATGCGCCTAGCTTCCGGATATCACCAAACCCCGGCACGAAAAGTGTCAAGGAACATGCAACTAAACAGCCTGCGTTCGCCTACCCGGAGACGGTGTTTGCGTGGACGCTGTGCTGCAATCTAAAGTCTAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCTAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGTGTCACAAATCGTCGTCCCCCCATCCTCTCGAGGATAATGGACGGAAGCTGGTCTCCCGTGTGTTACCGCACGCGGTTGGCCAAAATCCGAGCTAAGGACGCAAGGAGCGTCTCGACATGCGGTGGTGAATTAAAACCTCGTCATACCGTTGGCCGCTCCTGTCCTGATGCTCTCGATGACCCAAAGTCCTCA

Click for details-----ITS1

TCGATACCTTATCGTAAACAGAACGACCCGCGAACGATTGATCATCACTCTCAGTGGGCCGGTGTCTTAGCTGATTCCGTGCCCGCCGATTCCGTGGTTATGCGTGTGGTCTCAGCCAAGATTCATATCTCGGTTGGGTCATGCGCCTAGCTTACGGATATCACCAAACCCCGGCACGAAAAGTGTCAAGGAACATGCAACTAAACAGCCTGTGTTCGCCTACCCGGAGACGGTGTTTGCGTGGACGCTGTGCTGCAATCTAAAGTCTAAAA

Click for details-----ITS2

ATCGTCGTCCCCCCATCCTCTCGAGGATAATGGACGGAAGCTGGTCTCCCGTGTGTTACCGCACGCGGTTGGCCAAAATCCGAGCTAAGGACGCAAGGAGCGTCTCGACATGCGGTGGTGAATTAAAACCTCGTCATACCGTTGGCCGCTCCTGTCCTGATGCTCTCGATGACCCAAAGTCCTCA
Taxonomic Information

Plant ID: NPO4554
Plant Latin Name: Isatis Tinctoria
Taxonomy Genus: Isatis
Taxonomy Family: Brassicaceae

Plant External Links:

NCBI TaxonomyDB: 161756
Plant-of-the-World-Online: 285873-1

Used in Medicines

Country/Region:
China; India

Traditional Medicine System:
TCM

Geographical Distribution

Turkey; Italy; Mongolia; France; Peru; Norway; Uzbekistan; Belarus; Algeria; China; Belgium; Germany; Kazakhstan; Spain; Ukraine; Netherlands; Denmark; Poland; Finland; United States; Morocco; Sweden; Japan; Switzerland; Russia; Bulgaria; Pakistan; Romania; Albania; Portugal; South Africa; India; United Kingdom; Austria; Greece; Hungary; Tajikistan

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

283 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


208 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

169 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99583

Ingredient ID: NPC99572

Ingredient ID: NPC9825

Ingredient ID: NPC95615

Ingredient ID: NPC94267

Ingredient ID: NPC89778

Ingredient ID: NPC88724

Ingredient ID: NPC85488

Ingredient ID: NPC83214

Ingredient ID: NPC82963

Ingredient ID: NPC80710

Ingredient ID: NPC75717

Ingredient ID: NPC75716

Ingredient ID: NPC7551

Ingredient ID: NPC6717

Ingredient ID: NPC66700

Ingredient ID: NPC65680

Ingredient ID: NPC62927

Ingredient ID: NPC62765

Ingredient ID: NPC61198

Ingredient ID: NPC6027

Ingredient ID: NPC57974

Ingredient ID: NPC57863

Ingredient ID: NPC5413

Ingredient ID: NPC53545

Ingredient ID: NPC51986

Ingredient ID: NPC50763

Ingredient ID: NPC478795

Ingredient ID: NPC478794

Ingredient ID: NPC478793

Ingredient ID: NPC478792

Ingredient ID: NPC478791

Ingredient ID: NPC478790

Ingredient ID: NPC478789

Ingredient ID: NPC478788

Ingredient ID: NPC478787

Ingredient ID: NPC478786

Ingredient ID: NPC478785

Ingredient ID: NPC478784

Ingredient ID: NPC478783

Ingredient ID: NPC478782

Ingredient ID: NPC478781

Ingredient ID: NPC478780

Ingredient ID: NPC478779

Ingredient ID: NPC478778

Ingredient ID: NPC478777

Ingredient ID: NPC478776

Ingredient ID: NPC478775

Ingredient ID: NPC478774

Ingredient ID: NPC478773

Ingredient ID: NPC478772

Ingredient ID: NPC478771

Ingredient ID: NPC478770

Ingredient ID: NPC478769

Ingredient ID: NPC478768

Ingredient ID: NPC478767

Ingredient ID: NPC478766

Ingredient ID: NPC478765

Ingredient ID: NPC478764

Ingredient ID: NPC478763

Ingredient ID: NPC478762

Ingredient ID: NPC478761

Ingredient ID: NPC478760

Ingredient ID: NPC478759

Ingredient ID: NPC478758

Ingredient ID: NPC478757

Ingredient ID: NPC478756

Ingredient ID: NPC478755

Ingredient ID: NPC478754

Ingredient ID: NPC478753

Ingredient ID: NPC478752

Ingredient ID: NPC478751

Ingredient ID: NPC478750

Ingredient ID: NPC478749

Ingredient ID: NPC478748

Ingredient ID: NPC478747

Ingredient ID: NPC478746

Ingredient ID: NPC478745

Ingredient ID: NPC478744

Ingredient ID: NPC478743

Ingredient ID: NPC478742

Ingredient ID: NPC478741

Ingredient ID: NPC478740

Ingredient ID: NPC478739

Ingredient ID: NPC478738

Ingredient ID: NPC478737

Ingredient ID: NPC478736

Ingredient ID: NPC478735

Ingredient ID: NPC46161

Ingredient ID: NPC43246

Ingredient ID: NPC43087

Ingredient ID: NPC42563

Ingredient ID: NPC42372

Ingredient ID: NPC40432

Ingredient ID: NPC39392

Ingredient ID: NPC39391

Ingredient ID: NPC35099

Ingredient ID: NPC35046

Ingredient ID: NPC34103

Ingredient ID: NPC3357

Ingredient ID: NPC3295

Ingredient ID: NPC32163

Ingredient ID: NPC3165

Ingredient ID: NPC316055

Ingredient ID: NPC314711

Ingredient ID: NPC31432

Ingredient ID: NPC313550

Ingredient ID: NPC313179

Ingredient ID: NPC310665

Ingredient ID: NPC307755

Ingredient ID: NPC307050

Ingredient ID: NPC307007

Ingredient ID: NPC303689

Ingredient ID: NPC302857

Ingredient ID: NPC302856

Ingredient ID: NPC302003

Ingredient ID: NPC301950

Ingredient ID: NPC300017

Ingredient ID: NPC295021

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC293378

Ingredient ID: NPC292792

Ingredient ID: NPC290437

Ingredient ID: NPC289774

Ingredient ID: NPC289688

Ingredient ID: NPC288349

Ingredient ID: NPC287876

Ingredient ID: NPC284701

Ingredient ID: NPC284635

Ingredient ID: NPC284302

Ingredient ID: NPC278434

Ingredient ID: NPC277404

Ingredient ID: NPC274621

Ingredient ID: NPC27458

Ingredient ID: NPC273917

Ingredient ID: NPC271928

Ingredient ID: NPC270136

Ingredient ID: NPC266441

Ingredient ID: NPC265800

Ingredient ID: NPC260296

Ingredient ID: NPC258605

Ingredient ID: NPC258019

Ingredient ID: NPC257582

Ingredient ID: NPC257301

Ingredient ID: NPC257124

Ingredient ID: NPC255607

Ingredient ID: NPC254698

Ingredient ID: NPC254416

Ingredient ID: NPC253509

Ingredient ID: NPC252126

Ingredient ID: NPC2499

Ingredient ID: NPC249699

Ingredient ID: NPC249669

Ingredient ID: NPC249045

Ingredient ID: NPC246358

Ingredient ID: NPC245346

Ingredient ID: NPC243728

Ingredient ID: NPC242159

Ingredient ID: NPC241652

Ingredient ID: NPC23962

Ingredient ID: NPC239608

Ingredient ID: NPC235260

Ingredient ID: NPC232375

Ingredient ID: NPC230200

Ingredient ID: NPC229347

Ingredient ID: NPC228346

Ingredient ID: NPC227406

Ingredient ID: NPC226453

Ingredient ID: NPC226107

Ingredient ID: NPC226105

Ingredient ID: NPC225851

Ingredient ID: NPC225665

Ingredient ID: NPC224632

Ingredient ID: NPC221716

Ingredient ID: NPC22030

Ingredient ID: NPC21827

Ingredient ID: NPC216630

Ingredient ID: NPC209389

Ingredient ID: NPC209054

Ingredient ID: NPC208760

Ingredient ID: NPC20791

Ingredient ID: NPC207554

Ingredient ID: NPC207428

Ingredient ID: NPC206589

Ingredient ID: NPC204932

Ingredient ID: NPC203468

Ingredient ID: NPC202116

Ingredient ID: NPC201562

Ingredient ID: NPC20045

Ingredient ID: NPC195809

Ingredient ID: NPC19576

Ingredient ID: NPC194698

Ingredient ID: NPC192402

Ingredient ID: NPC191857

Ingredient ID: NPC191693

Ingredient ID: NPC190810

Ingredient ID: NPC19044

Ingredient ID: NPC189817

Ingredient ID: NPC187998

Ingredient ID: NPC187770

Ingredient ID: NPC186653

Ingredient ID: NPC184416

Ingredient ID: NPC18216

Ingredient ID: NPC18188

Ingredient ID: NPC179950

Ingredient ID: NPC178970

Ingredient ID: NPC178681

Ingredient ID: NPC175313

Ingredient ID: NPC175143

Ingredient ID: NPC173486

Ingredient ID: NPC172801

Ingredient ID: NPC172800

Ingredient ID: NPC17131

Ingredient ID: NPC170826

Ingredient ID: NPC169056

Ingredient ID: NPC168951

Ingredient ID: NPC168129

Ingredient ID: NPC167976

Ingredient ID: NPC166958

Ingredient ID: NPC166018

Ingredient ID: NPC165159

Ingredient ID: NPC164664

Ingredient ID: NPC161972

Ingredient ID: NPC161557

Ingredient ID: NPC158702

Ingredient ID: NPC158404

Ingredient ID: NPC158079

Ingredient ID: NPC157192

Ingredient ID: NPC156461

Ingredient ID: NPC154172

Ingredient ID: NPC154016

Ingredient ID: NPC153572

Ingredient ID: NPC152478

Ingredient ID: NPC150958

Ingredient ID: NPC150323

Ingredient ID: NPC150020

Ingredient ID: NPC149494

Ingredient ID: NPC147957

Ingredient ID: NPC146370

Ingredient ID: NPC144434

Ingredient ID: NPC14330

Ingredient ID: NPC143280

Ingredient ID: NPC142753

Ingredient ID: NPC141765

Ingredient ID: NPC138113

Ingredient ID: NPC136473

Ingredient ID: NPC134717

Ingredient ID: NPC133671

Ingredient ID: NPC132307

Ingredient ID: NPC130931

Ingredient ID: NPC130754

Ingredient ID: NPC128143

Ingredient ID: NPC126925

Ingredient ID: NPC126409

Ingredient ID: NPC123304

Ingredient ID: NPC12319

Ingredient ID: NPC122510

Ingredient ID: NPC12166

Ingredient ID: NPC121656

Ingredient ID: NPC119107

Ingredient ID: NPC118202

Ingredient ID: NPC117652

Ingredient ID: NPC116906

Ingredient ID: NPC116775

Ingredient ID: NPC115207

Ingredient ID: NPC114977

Ingredient ID: NPC114975

Ingredient ID: NPC114682

Ingredient ID: NPC11433

Ingredient ID: NPC113776

Ingredient ID: NPC112701

Ingredient ID: NPC111897

Ingredient ID: NPC111275

Ingredient ID: NPC111249

Ingredient ID: NPC110539

Ingredient ID: NPC108358

Ingredient ID: NPC1075

Ingredient ID: NPC107482

Ingredient ID: NPC107373

Ingredient ID: NPC106312

Ingredient ID: NPC103887

Ingredient ID: NPC100551