• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Teucrium Marum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTTCAAAACGACCGCGAACAAGTGCTCAACAAAATCGGGCCGGCTGAGAGGGGGCCGCGCCTCGCTCCAGGCTTCCCCAACCCCTGACGGGATGTGCGCTCGTGCGCGTTCCGTGCGGGTCTAACAAACCCGGGCACGGAATGTATCAAGGAAAATTCAATGGAACATCCCCCGCCCGTCGCCCGTAGACGGTGCGTGGGCGGGGACCGGGCGTCGATCGTAATACTAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGCCCCTTTCCCCCCTCAAGAGCGGTGGGGCGGAGAATGGCCTCCCGTGTGCTACCCCGCGCGGGTGGCCTAAATGCGCTCCCCCGACGAACGCACGTCGCGACAAGTGGTAGTGAACTATCAACTCGTCGTGCTGTCGCGGTCAGAGGCGTCAGTTCCCGAGAACCACAAGACCCAACGGCGCGCCCCGCCTAC

Click for details-----ITS1

TCGAAACCTTCAAAACGACCGCGAACAAGTGCTCAACAAAATCGGGCCGGCTGAGAGGGGGCCGCGCCTCGCTCCAGGCTTCCCCAACCCCTGACGGGATGTGCGCTCGTGCGCGTTCCGTGCGGGTCTAACAAACCCGGGCACGGAATGTATCAAGGAAAATTCAATGGAACATCCCCCGCCCGTCGCCCGTAGACGGTGCGTGGGCGGGGACCGGGCGTCGATCGTAATACTAAAA

Click for details-----ITS2

CATCGTCGCCCCTTTCCCCCCTCAAGAGCGGTGGGGCGGAGAATGGCCTCCCGTGTGCTACCCCGCGCGGGTGGCCTAAATGCGCTCCCCCGACGAACGCACGTCGCGACAAGTGGTAGTGAACTATCAACTCGTCGTGCTGTCGCGGTCAGAGGCGTCAGTTCCCGAGAACCACAAGACCCAACGGCGCGCCCCGCCTAC
Taxonomic Information

Plant ID: NPO453
Plant Latin Name: Teucrium Marum
Taxonomy Genus: Teucrium
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 711380
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM


Medicinal Functions:

Aromatic; Astringent; Deobstruent; Diuretic; Nervine; Stimulant; Stomachic; Tonic

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

10 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


6 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

5 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC39426

Ingredient ID: NPC313163

Ingredient ID: NPC243728

Ingredient ID: NPC234591

Ingredient ID: NPC234333

Ingredient ID: NPC161749

Ingredient ID: NPC16050

Ingredient ID: NPC154429

Ingredient ID: NPC1517

Ingredient ID: NPC149527