• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Hypericum Perforatum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

ACAATCCCTTTGTGAACCCCCGGAAGGATTATTGTCGAAACCTCCAAATGACCCGCGAACTAGTTATCCACAAGTCGGGGGTGTCGTGGGCTTCTGTCCCGGCGCCCCCGTGCCGGGGGTGGCCAGGCGCGCCAAGCTCTTGGCACGGCTGGCCCATCACCTGCCCAACAAACAAACCCCGGCGCGGCACGCGCCAAGGAACTTTTGCATCATAAGAAGTGTAACGCTCCCGGCTGTGCCGGAAATCGGACAACACGGTCGGGGGCTTCCTTCTGTTCATAACAATAACGACTCTCGGCAACGGATATCTAGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGCCTGCCTGGGTGTCACACATCGTCGCCCCCCAAAATCCCGATATCTCGCAAGAGACAATCGGGAATAGGATGGGCGGAAAATGGTCTCCCGTGCGCTCCCGTTCGCGGTTGGCCCAAAAATGAGTTCCTGGCAAAGCAAAGCCACGACCAGCGGTGGTTGTAAGACCCTCGGTACAAGTCGTGAGCCTTGCATTGCTCGTAGGGACATGTTGACCCTGAACGTGATCGAGTAACATCGAACACTCACA

Click for details-----ITS1

ACAATCCCTTTGTGAACCCCCGGAAGGATTATTGTCGAAACCTCCAAATGACCCGCGAACTAGTTATCCACAAGTCGGGGGTGTCGTGGGCTTCTGTCCCGGCGCCCCCGTGCCGGGGGTGGCCAGGCGCGCCAAGCTCTTGGCACGGCTGGCCCATCACCTGCCCAACAAACAAACCCCGGCGCGGCACGCGCCAAGGAACTTTTGCATCATAAGAAGTGTAACGCTCCCGGCTGTGCCGGAAATCGGACAACACGGTCGGGGGCTTCCTTCTGTTCATAACAATAA

Click for details-----ITS2

ATCGTCGCCCCCCAAAATCCCGATATCTYGCAAGASACAATCGGGMATAGGATGGGCGGAAAATGGTCTCCCGTGCGCTCCCGTTCGCGGTTGGCCCAAAAATGAGTTCCTGGCAAAGCAAAGCCACGACCAGCGGTGGTTGTAAGACCCTCGGTACAAGTCGTGAGCCTTGCATTGCTCGTAGGGACATGTTGACCCTGAACGTGATCGAGTAACATCGGAACACTCACAAA
Taxonomic Information

Plant ID: NPO4391
Plant Latin Name: Hypericum Perforatum
Taxonomy Genus: Hypericum
Taxonomy Family: Hypericaceae

Plant External Links:

NCBI TaxonomyDB: 65561
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Turkey; Australia; Italy; Turkmenistan; South Africa; India; Lithuania; United States; Albania; Germany; Chile; Greece; Lebanon; Argentina; China; New Zealand; Spain

Traditional Medicine System:
TCM; Homeopathy; Siddha


Medicinal Functions:

Analgesic; Antidepressant; Antiseptic; Antispasmodic; Aromatic; Astringent; Cholagogue; Digestive; Diuretic; Expectorant; Homeopathy; Nervine; Resolvent; Sedative; Stimulant; Vermifuge; Vulnerary

Geographical Distribution

Turkey; Australia; Italy; Turkmenistan; South Africa; Lebanon; India; United States; Albania; Germany; Spain; Chile; Greece; China; Argentina; New Zealand; Lithuania

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available
Compounds Summary

Overview of Ingredients

395 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


243 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

174 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.





Ingredient Structrual Cards

Ingredient ID: NPC99657

Ingredient ID: NPC99480

Ingredient ID: NPC98356

Ingredient ID: NPC95969

Ingredient ID: NPC95675

Ingredient ID: NPC9424

Ingredient ID: NPC92774

Ingredient ID: NPC92032

Ingredient ID: NPC91574

Ingredient ID: NPC90904

Ingredient ID: NPC90889

Ingredient ID: NPC90803

Ingredient ID: NPC90506

Ingredient ID: NPC90232

Ingredient ID: NPC88923

Ingredient ID: NPC88907

Ingredient ID: NPC88789

Ingredient ID: NPC88566

Ingredient ID: NPC87081

Ingredient ID: NPC86939

Ingredient ID: NPC86538

Ingredient ID: NPC86412

Ingredient ID: NPC86156

Ingredient ID: NPC86154

Ingredient ID: NPC85473

Ingredient ID: NPC85305

Ingredient ID: NPC84811

Ingredient ID: NPC82648

Ingredient ID: NPC8123

Ingredient ID: NPC81010

Ingredient ID: NPC80090

Ingredient ID: NPC7965

Ingredient ID: NPC79056

Ingredient ID: NPC78551

Ingredient ID: NPC78540

Ingredient ID: NPC76145

Ingredient ID: NPC75584

Ingredient ID: NPC75204

Ingredient ID: NPC7491

Ingredient ID: NPC74569

Ingredient ID: NPC7314

Ingredient ID: NPC72973

Ingredient ID: NPC71853

Ingredient ID: NPC71703

Ingredient ID: NPC71665

Ingredient ID: NPC71506

Ingredient ID: NPC70744

Ingredient ID: NPC7057

Ingredient ID: NPC68889

Ingredient ID: NPC68052

Ingredient ID: NPC67761

Ingredient ID: NPC67591

Ingredient ID: NPC67037

Ingredient ID: NPC66577

Ingredient ID: NPC65966

Ingredient ID: NPC64628

Ingredient ID: NPC64347

Ingredient ID: NPC64176

Ingredient ID: NPC61769

Ingredient ID: NPC61477

Ingredient ID: NPC60556

Ingredient ID: NPC60419

Ingredient ID: NPC60288

Ingredient ID: NPC59581

Ingredient ID: NPC59570

Ingredient ID: NPC58970

Ingredient ID: NPC57877

Ingredient ID: NPC5683

Ingredient ID: NPC53545

Ingredient ID: NPC52897

Ingredient ID: NPC5275

Ingredient ID: NPC52230

Ingredient ID: NPC51758

Ingredient ID: NPC51443

Ingredient ID: NPC51189

Ingredient ID: NPC49151

Ingredient ID: NPC49053

Ingredient ID: NPC483064

Ingredient ID: NPC483063

Ingredient ID: NPC483062

Ingredient ID: NPC483061

Ingredient ID: NPC483060

Ingredient ID: NPC483059

Ingredient ID: NPC483058

Ingredient ID: NPC483057

Ingredient ID: NPC483056

Ingredient ID: NPC483055

Ingredient ID: NPC483054

Ingredient ID: NPC483053

Ingredient ID: NPC483052

Ingredient ID: NPC483051

Ingredient ID: NPC47993

Ingredient ID: NPC479379

Ingredient ID: NPC478721

Ingredient ID: NPC478720

Ingredient ID: NPC478719

Ingredient ID: NPC478718

Ingredient ID: NPC478717

Ingredient ID: NPC47844

Ingredient ID: NPC45727

Ingredient ID: NPC45270

Ingredient ID: NPC44963

Ingredient ID: NPC44842

Ingredient ID: NPC44328

Ingredient ID: NPC43728

Ingredient ID: NPC43114

Ingredient ID: NPC42760

Ingredient ID: NPC41845

Ingredient ID: NPC4154

Ingredient ID: NPC41385

Ingredient ID: NPC41180

Ingredient ID: NPC41007

Ingredient ID: NPC39360

Ingredient ID: NPC38751

Ingredient ID: NPC38497

Ingredient ID: NPC38104

Ingredient ID: NPC37709

Ingredient ID: NPC3649

Ingredient ID: NPC36408

Ingredient ID: NPC36083

Ingredient ID: NPC35744

Ingredient ID: NPC35519

Ingredient ID: NPC35448

Ingredient ID: NPC34764

Ingredient ID: NPC34440

Ingredient ID: NPC33489

Ingredient ID: NPC31789

Ingredient ID: NPC314315

Ingredient ID: NPC31371

Ingredient ID: NPC310862

Ingredient ID: NPC310820

Ingredient ID: NPC309182

Ingredient ID: NPC307984

Ingredient ID: NPC306990

Ingredient ID: NPC306207

Ingredient ID: NPC30430

Ingredient ID: NPC302857

Ingredient ID: NPC300649

Ingredient ID: NPC30025

Ingredient ID: NPC29936

Ingredient ID: NPC297528

Ingredient ID: NPC297422

Ingredient ID: NPC296146

Ingredient ID: NPC2951

Ingredient ID: NPC294902

Ingredient ID: NPC294136

Ingredient ID: NPC292092

Ingredient ID: NPC290194

Ingredient ID: NPC290189

Ingredient ID: NPC290078

Ingredient ID: NPC289366

Ingredient ID: NPC289120

Ingredient ID: NPC288932

Ingredient ID: NPC288840

Ingredient ID: NPC287660

Ingredient ID: NPC287335

Ingredient ID: NPC285793

Ingredient ID: NPC283178

Ingredient ID: NPC282694

Ingredient ID: NPC281131

Ingredient ID: NPC281128

Ingredient ID: NPC279969

Ingredient ID: NPC278711

Ingredient ID: NPC278683

Ingredient ID: NPC278068

Ingredient ID: NPC277907

Ingredient ID: NPC277736

Ingredient ID: NPC277304

Ingredient ID: NPC27657

Ingredient ID: NPC276264

Ingredient ID: NPC27584

Ingredient ID: NPC275685

Ingredient ID: NPC275463

Ingredient ID: NPC275255

Ingredient ID: NPC274681

Ingredient ID: NPC274584

Ingredient ID: NPC273825

Ingredient ID: NPC273385

Ingredient ID: NPC272651

Ingredient ID: NPC272552

Ingredient ID: NPC271321

Ingredient ID: NPC271087

Ingredient ID: NPC270578

Ingredient ID: NPC26974

Ingredient ID: NPC26960

Ingredient ID: NPC269145

Ingredient ID: NPC26906

Ingredient ID: NPC268164

Ingredient ID: NPC267649

Ingredient ID: NPC266706

Ingredient ID: NPC263290

Ingredient ID: NPC262505

Ingredient ID: NPC261991

Ingredient ID: NPC261619

Ingredient ID: NPC255615

Ingredient ID: NPC254847

Ingredient ID: NPC254770

Ingredient ID: NPC254156

Ingredient ID: NPC25275

Ingredient ID: NPC252558

Ingredient ID: NPC252539

Ingredient ID: NPC252268

Ingredient ID: NPC251619

Ingredient ID: NPC250234

Ingredient ID: NPC249815

Ingredient ID: NPC249009

Ingredient ID: NPC248726

Ingredient ID: NPC248056

Ingredient ID: NPC246544

Ingredient ID: NPC246543

Ingredient ID: NPC246165

Ingredient ID: NPC245858

Ingredient ID: NPC24327

Ingredient ID: NPC242314

Ingredient ID: NPC241721

Ingredient ID: NPC239609

Ingredient ID: NPC239039

Ingredient ID: NPC239037

Ingredient ID: NPC237532

Ingredient ID: NPC236202

Ingredient ID: NPC235260

Ingredient ID: NPC233533

Ingredient ID: NPC233473

Ingredient ID: NPC232880

Ingredient ID: NPC232375

Ingredient ID: NPC231738

Ingredient ID: NPC23145

Ingredient ID: NPC230616

Ingredient ID: NPC228383

Ingredient ID: NPC227986

Ingredient ID: NPC227841

Ingredient ID: NPC227839

Ingredient ID: NPC227049

Ingredient ID: NPC225463

Ingredient ID: NPC225060

Ingredient ID: NPC22484

Ingredient ID: NPC223455

Ingredient ID: NPC22229

Ingredient ID: NPC220860

Ingredient ID: NPC220825

Ingredient ID: NPC220724

Ingredient ID: NPC22054

Ingredient ID: NPC219876

Ingredient ID: NPC218918

Ingredient ID: NPC218109

Ingredient ID: NPC216410

Ingredient ID: NPC21584

Ingredient ID: NPC215632

Ingredient ID: NPC214909

Ingredient ID: NPC214584

Ingredient ID: NPC213749

Ingredient ID: NPC210659

Ingredient ID: NPC210003

Ingredient ID: NPC209970

Ingredient ID: NPC209279

Ingredient ID: NPC209275

Ingredient ID: NPC208764

Ingredient ID: NPC20791

Ingredient ID: NPC20742

Ingredient ID: NPC205265

Ingredient ID: NPC204932

Ingredient ID: NPC204759

Ingredient ID: NPC203388

Ingredient ID: NPC202189

Ingredient ID: NPC201077

Ingredient ID: NPC200618

Ingredient ID: NPC200129

Ingredient ID: NPC199310

Ingredient ID: NPC198658

Ingredient ID: NPC196711

Ingredient ID: NPC196277

Ingredient ID: NPC195940

Ingredient ID: NPC195938

Ingredient ID: NPC194856

Ingredient ID: NPC194688

Ingredient ID: NPC194586

Ingredient ID: NPC194367

Ingredient ID: NPC193180

Ingredient ID: NPC192065

Ingredient ID: NPC191498

Ingredient ID: NPC190810

Ingredient ID: NPC189853

Ingredient ID: NPC188238

Ingredient ID: NPC185041

Ingredient ID: NPC184049

Ingredient ID: NPC1838

Ingredient ID: NPC182724

Ingredient ID: NPC182102

Ingredient ID: NPC180871

Ingredient ID: NPC179950

Ingredient ID: NPC17810

Ingredient ID: NPC177112

Ingredient ID: NPC176819

Ingredient ID: NPC176740

Ingredient ID: NPC176684

Ingredient ID: NPC175987

Ingredient ID: NPC175913

Ingredient ID: NPC175108

Ingredient ID: NPC173638

Ingredient ID: NPC173637

Ingredient ID: NPC171816

Ingredient ID: NPC171568

Ingredient ID: NPC168943

Ingredient ID: NPC168714

Ingredient ID: NPC167976

Ingredient ID: NPC166692

Ingredient ID: NPC1656

Ingredient ID: NPC163984

Ingredient ID: NPC16157

Ingredient ID: NPC160996

Ingredient ID: NPC16087

Ingredient ID: NPC16070

Ingredient ID: NPC15970

Ingredient ID: NPC157781

Ingredient ID: NPC157410

Ingredient ID: NPC157156

Ingredient ID: NPC156655

Ingredient ID: NPC156654

Ingredient ID: NPC15658

Ingredient ID: NPC155763

Ingredient ID: NPC155182

Ingredient ID: NPC154361

Ingredient ID: NPC154172

Ingredient ID: NPC153958

Ingredient ID: NPC152964

Ingredient ID: NPC1524

Ingredient ID: NPC150329

Ingredient ID: NPC149975

Ingredient ID: NPC149168

Ingredient ID: NPC148671

Ingredient ID: NPC146192

Ingredient ID: NPC14594

Ingredient ID: NPC14576

Ingredient ID: NPC145038

Ingredient ID: NPC14426

Ingredient ID: NPC144023

Ingredient ID: NPC143639

Ingredient ID: NPC142924

Ingredient ID: NPC13991

Ingredient ID: NPC139619

Ingredient ID: NPC139546

Ingredient ID: NPC138883

Ingredient ID: NPC138347

Ingredient ID: NPC138299

Ingredient ID: NPC138113

Ingredient ID: NPC13789

Ingredient ID: NPC135088

Ingredient ID: NPC135077

Ingredient ID: NPC13373

Ingredient ID: NPC131770

Ingredient ID: NPC131769

Ingredient ID: NPC12845

Ingredient ID: NPC12774

Ingredient ID: NPC127546

Ingredient ID: NPC127122

Ingredient ID: NPC126029

Ingredient ID: NPC125169

Ingredient ID: NPC125062

Ingredient ID: NPC125017

Ingredient ID: NPC124885

Ingredient ID: NPC124876

Ingredient ID: NPC124161

Ingredient ID: NPC123229

Ingredient ID: NPC12269

Ingredient ID: NPC122487

Ingredient ID: NPC121322

Ingredient ID: NPC120926

Ingredient ID: NPC119823

Ingredient ID: NPC119224

Ingredient ID: NPC118695

Ingredient ID: NPC118284

Ingredient ID: NPC117493

Ingredient ID: NPC116775

Ingredient ID: NPC114992

Ingredient ID: NPC1144

Ingredient ID: NPC114239

Ingredient ID: NPC109838

Ingredient ID: NPC109813

Ingredient ID: NPC108811

Ingredient ID: NPC108494

Ingredient ID: NPC107540

Ingredient ID: NPC1075

Ingredient ID: NPC107015

Ingredient ID: NPC106819

Ingredient ID: NPC106250

Ingredient ID: NPC105585

Ingredient ID: NPC105557

Ingredient ID: NPC104724

Ingredient ID: NPC10455

Ingredient ID: NPC103387

Ingredient ID: NPC101285

Ingredient ID: NPC100734

Ingredient ID: NPC100570

Ingredient ID: NPC100559

Ingredient ID: NPC100380

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target Type Protein Class Gene ID Protein Name Uniprot ID Target ChEMBL ID
Cytochrome P450 Cytochrome P450 family 1 CYP1A2 Cytochrome P450 1A2 P05177 CHEMBL3356
Cytochrome P450 Cytochrome P450 family 1 CYP1A1 Cytochrome P450 1A1 P04798 CHEMBL2231
Cytochrome P450 Cytochrome P450 family 1 CYP1B1 Cytochrome P450 1B1 Q16678 CHEMBL4878
Cytochrome P450 Cytochrome P450 family 19 CYP19A1 Cytochrome P450 19A1 P11511 CHEMBL1978
Cytochrome P450 Cytochrome P450 family 2 CYP2C19 Cytochrome P450 2C19 P33261 CHEMBL3622
Cytochrome P450 Cytochrome P450 family 3 CYP3A4 Cytochrome P450 3A4 P08684 CHEMBL340
Therapeutic Target Enzyme NOX4 NADPH oxidase 4 Q9NPH5 CHEMBL1250375
Therapeutic Target Enzyme ALOX12 Arachidonate 12-lipoxygenase P18054 CHEMBL3687
Therapeutic Target Enzyme APEX1 DNA-(apurinic or apyrimidinic site) lyase P27695 CHEMBL5619
Therapeutic Target Enzyme ALPL Alkaline phosphatase, tissue-nonspecific isozyme P05186 CHEMBL5979
Therapeutic Target Enzyme RECQL ATP-dependent DNA helicase Q1 P46063 CHEMBL1293236
Therapeutic Target Enzyme POLB DNA polymerase beta P06746 CHEMBL2392
Therapeutic Target Hydrolase BCHE Butyrylcholinesterase P06276 CHEMBL1914
Therapeutic Target Hydrolase ACHE Acetylcholinesterase P22303 CHEMBL220
Therapeutic Target Lyase CA12 Carbonic anhydrase XII O43570 CHEMBL3242
Therapeutic Target Lyase CA7 Carbonic anhydrase VII P43166 CHEMBL2326
Therapeutic Target Lyase CA2 Carbonic anhydrase II P00918 CHEMBL205
Therapeutic Target Lyase CA14 Carbonic anhydrase XIV Q9ULX7 CHEMBL3510
Therapeutic Target Lyase CA4 Carbonic anhydrase IV P22748 CHEMBL3729
Therapeutic Target Membrane receptor APP Beta amyloid A4 protein P05067 CHEMBL2487
Therapeutic Target Metallo protease MMP2 Matrix metalloproteinase-2 P08253 CHEMBL333
Therapeutic Target Metallo protease MMP1 Matrix metalloproteinase-1 P03956 CHEMBL332
Therapeutic Target Metallo protease MMP9 Matrix metalloproteinase 9 P14780 CHEMBL321
Therapeutic Target Methyl-lysine/arginine binding protein SMN1 Survival motor neuron protein Q16637 CHEMBL1293232
Therapeutic Target Nicotinic acetylcholine receptor CHRNE Acetylcholine receptor protein epsilon chain Q04844 CHEMBL2484
Therapeutic Target Nuclear hormone receptor subfamily 1 NR1H4 Bile acid receptor FXR Q96RI1 CHEMBL2047
Therapeutic Target Nuclear hormone receptor subfamily 1 NR1I2 Pregnane X receptor O75469 CHEMBL3401
Therapeutic Target Oxidoreductase MAOA Monoamine oxidase A P21397 CHEMBL1951
Therapeutic Target Oxidoreductase HSD17B10 Endoplasmic reticulum-associated amyloid beta-peptide-binding protein Q99714 CHEMBL4159
Therapeutic Target Oxidoreductase CBR1 Carbonyl reductase [NADPH] 1 P16152 CHEMBL5586
Therapeutic Target Oxidoreductase HSD17B2 Estradiol 17-beta-dehydrogenase 2 P37059 CHEMBL2789
Therapeutic Target Oxidoreductase XDH Xanthine dehydrogenase P47989 CHEMBL1929
Therapeutic Target Peptide receptor (family A GPCR) TSHR Thyroid stimulating hormone receptor P16473 CHEMBL1963
Therapeutic Target Peptide receptor (family A GPCR) NPSR1 Neuropeptide S receptor Q6W5P4 CHEMBL5162
Therapeutic Target Peptide receptor (family A GPCR) OPRD1 Delta opioid receptor P41143 CHEMBL236
Therapeutic Target Peptide receptor (family B GPCR) CRHR1 Corticotropin releasing factor receptor 1 P34998 CHEMBL1800
Therapeutic Target Protein Kinase KDR Vascular endothelial growth factor receptor 2 P35968 CHEMBL279
Therapeutic Target Protein Kinase CDK6 Cyclin-dependent kinase 6 Q00534 CHEMBL2508
Therapeutic Target Protein Kinase AXL Tyrosine-protein kinase receptor UFO P30530 CHEMBL4895
Therapeutic Target Protein Kinase PIM1 Serine/threonine-protein kinase PIM1 P11309 CHEMBL2147
Therapeutic Target Protein Kinase CSNK2A1 Casein kinase II alpha P68400 CHEMBL3629
Therapeutic Target Protein Kinase IGF1R Insulin-like growth factor I receptor P08069 CHEMBL1957
Therapeutic Target Protein Kinase YES1 Tyrosine-protein kinase YES P07947 CHEMBL2073
Therapeutic Target Protein Kinase AURKB Serine/threonine-protein kinase Aurora-B Q96GD4 CHEMBL2185
Therapeutic Target Protein Kinase CDK1 Cyclin-dependent kinase 1 P06493 CHEMBL308
Therapeutic Target Protein Kinase FLT3 Tyrosine-protein kinase receptor FLT3 P36888 CHEMBL1974
Therapeutic Target Protein Kinase MET Hepatocyte growth factor receptor P08581 CHEMBL3717
Drug Transporter SLC superfamily of solute carriers SLC22A2 Solute carrier family 22 member 2 O15244 CHEMBL1743122
Drug Transporter SLC superfamily of solute carriers SLCO1B1 Solute carrier organic anion transporter family member 1B1 Q9Y6L6 CHEMBL1697668
Therapeutic Target Small molecule receptor (family A GPCR) CNR2 Cannabinoid CB2 receptor P34972 CHEMBL253
Therapeutic Target Small molecule receptor (family A GPCR) DRD3 Dopamine D3 receptor P35462 CHEMBL234
Therapeutic Target Structural protein LMNA Prelamin-A/C P02545 CHEMBL1293235
Therapeutic Target Threonine protease PSMB1 Proteasome component C5 P20618 CHEMBL4208
Therapeutic Target Transcription factor AHR Aryl hydrocarbon receptor P35869 CHEMBL3201
Therapeutic Target Transcription factor NFKB1 Nuclear factor NF-kappa-B p105 subunit P19838 CHEMBL3251
Therapeutic Target Transcription factor TP53 Cellular tumor antigen p53 P04637 CHEMBL4096
Therapeutic Target Transferase FDPS Farnesyl diphosphate synthase P14324 CHEMBL1782
Therapeutic Target Unclassified protein SNCA Alpha-synuclein P37840 CHEMBL6152
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
NP level119
Plant level20
Clinical trial details
NCT ID Title Condition Form in clinical use Associated by plant or compound
NCT02484170 Mannitol Cream for Post Herpetic Neuralgia postherpetic neuralgia Mannitol (NPC86412) NP level
NCT02621060 Effect of Chlorogenic Acid on Patients With Impaired Glucose Tolerance abnormal glucose tolerance Chlorogenic Acid (NPC302857) NP level
NCT00810940 Controlled Trial of ABELADRUG200 in Closed, Severe Head Injury injury Mannitol (NPC86412) NP level
NCT00792714 Pharmacokinetics of Inhaled Mannitol in Cystic Fibrosis Patients cystic fibrosis Mannitol (NPC86412) NP level
NCT03783819 Effects of Hypericum Perforatum Oil on Promoting Skin Recovery in Different Human Skin Damage Models Skin Recovery in Different Human Skin Damage Models Hypericum Perforatum Plant level
As plant Extract
NCT00041171 Docetaxel and St. John's Wort in Treating Patients With Solid Tumors That Cannot Be Removed By Surgery Adult Solid Tumor|Breast Cancer|Head and Neck Cancer|Kidney and Urinary Cancer|Male Reproductive Cancer|Thorax and Respiratory Cancer Hypericum Perforatum Plant level
As single plant
NCT02848131 Senescence in Chronic Kidney Disease chronic kidney disease Quercetin (NPC20791) NP level
NCT00587860 A Placebo-Controlled Trial of St. John's Wort for Irritable Bowel Syndrome Irritable Bowel Syndrome Hypericum Perforatum Plant level
As single plant
NCT00275418 Beta Carotene From Natural Source for Patients With Non-Active Crohn's Disease Crohn's disease Beta Carotene (NPC17810) NP level
NCT05477472 Low Dose St John's Wort for Depression Major Depression Hypericum Perforatum Plant level
As single plant
NCT03943459 Sirtuin-1 and Advanced Glycation End-products in Postmenopausal Women With Coronary Disease coronary artery disease Quercetin (NPC20791) NP level
NCT00782080 Efficacy and Safety of St. John´s Wort/Valerian Extract Versus Placebo in Children and Adolescents With ADHD ADHD Hypericum Perforatum Plant level
As single plant
NCT01311362 Influence of Cytochrome CYP3A4-induction by St. John's Wort on the Steady State Pharmacokinetics of Ambrisentan Drug Interactions Hypericum Perforatum Plant level
As single plant
NCT02684786 A Study of Stellate Ganglion Block and / or Reserpine in Group 2 Pulmonary Hypertension pulmonary arterial hypertension Reserpine (NPC88923) NP level
NCT00000645 A Phase I Dose Escalation Study of Synthetic Hypericin in HIV-Infected Patients With Less Than 300 CD4 Lymphocytes HIV infection Hypericin (NPC227841) NP level
NCT02660112 (+) Epicatechin to Treat Friedreich's Ataxia Friedreich ataxia (+)-Epicatechin (NPC261619) NP level
NCT01233492 Boron Phenylalanine With or Without Mannitol in Treating Patients With Glioblastoma Multiforme Central Nervous System Neoplasm Mannitol (NPC86412) NP level
NCT02136342 Phase 1 Trial of Chlorogenic Acid in Patients With Advanced Cancer cancer Chlorogenic Acid (NPC302857) NP level
NCT04476953 COVID-FISETIN: Pilot in SARS-CoV-2 of Fisetin to Alleviate Dysfunction and Inflammation COVID-19 Fisetin (NPC51443) NP level
NCT00730977 A Pilot Study to Investigate Administration of Mannitol Via a Novel Dry Powder Inhaler Device Bronchiectasis Mannitol (NPC86412) NP level
NCT03749408 Effect of Addition of Mannitol to Bupivacaine on IANB Success and Post-endodontic Pain pulpitis Mannitol (NPC86412) NP level
NCT01142505 Wheeze and Intermittent Treatment wheezing Mannitol (NPC86412) NP level
NCT00033033 Reserpine for the Treatment of Cocaine Dependence - 1 cocaine dependence Reserpine (NPC88923) NP level
NCT04385264 COVID-19 Mannitol (NPC86412) NP level
NCT02570971 Mannitol Versus Supportive Care in Ciguatera Fish Poisoning ciguatera poisoning Mannitol (NPC86412) NP level
NCT01883531 Crossover Trial Determining the Efficacy of Dry Powder Mannitol to Improve Lung Function in Subjects Aged 6-17 Years cystic fibrosis Mannitol (NPC86412) NP level
NCT00455416 Dietary Intervention in Follicular Lymphoma follicular lymphoma Quercetin (NPC20791) NP level
NCT02728687 Topical Menthol +/- Mannitol for Painful Diabetic Peripheral Neuropathy diabetic neuropathy Mannitol (NPC86412) NP level
NCT01921881 Does the Natural Medicinal Plant St John's Wort Affect the Glucose Tolerance in Healthy Individuals Type 2 Diabetes Hypericum Perforatum Plant level
As single plant
NCT04392622 d-Limonene +Radiation +Platinum Based Chemo for Xerostomia Prevention in Locally Advanced Head and Neck Squamous Cell Carcinoma xerostomia Limonene (NPC76145) NP level
NCT00630812 Long Term Administration of Inhaled Mannitol in Cystic Fibrosis cystic fibrosis Mannitol (NPC86412) NP level
NCT03747679 Palatability (Taste) of Oral Formulations of Bosutinib chronic myelogenous leukemia Mannitol (NPC86412) NP level
NCT02134353 A Safety and Efficacy Trial of Inhaled Mannitol in Adult Cystic Fibrosis Subjects cystic fibrosis Mannitol (NPC86412) NP level
NCT00000152 Randomized Trial of Beta-Carotene and Macular Degeneration macular degeneration Beta Carotene (NPC17810) NP level
NCT02552888 Nitrite, Isoquercetin and Endothelial Dysfunction (NICE) Trial chronic kidney disease Isoquercetin (NPC179950) NP level
NCT01258504 Influence of CYP3A4-induction by St. John's Wort on the Steady State Pharmacokinetics of Bosentan Drug Interactions Hypericum Perforatum Plant level
As single plant
NCT01348204 Nasal Potential Studies Utilizing Cystic Fibrosis Transmembrane Regulator (CFTR) Modulators cystic fibrosis Quercetin (NPC20791) NP level
NCT00100295 Herbal Treatment for Attention Deficit Hyperactivity Disorder (ADHD) Attention Deficit Hyperactivity Disorder Hypericum Perforatum Plant level
As single plant
NCT01330589 Pharmacodynamic Study on Efficacy of Clopidogrel With St. John's Wort Acute Coronary Syndrome Hypericum Perforatum Plant level
As single plant
NCT04733534 An Open-Label Intervention Trial to Reduce Senescence and Improve Frailty in Adult Survivors of Childhood Cancer childhood cancer Quercetin (NPC20791);Fisetin (NPC51443) NP level
NCT01076491 High Dose Inhaled Mannitol Study Bronchiectasis Mannitol (NPC86412) NP level
NCT04733651 Study to Investigate the Clinical Efficacy of Isoquercetin in Patients With COVID-19 COVID-19 Isoquercetin (NPC179950) NP level
NCT04771611 COVFIS-HOME: COVID-19 Pilot Study of Fisetin to Alleviate Dysfunction and Decrease Complications COVID-19 Fisetin (NPC51443) NP level
NCT03989271 Biological Effects of Quercetin in COPD chronic obstructive pulmonary disease Quercetin (NPC20791) NP level
NCT04815902 Use of Senolytic and Anti-Fibrotic Agents to Improve the Beneficial Effect of Bone Marrow Stem Cells for Osteoarthritis osteoarthritis, knee Fisetin (NPC51443) NP level
NCT01912820 Effect of Quercetin on Green Tea Polyphenol Uptake in Prostate Tissue From Patients With Prostate Cancer Undergoing Surgery prostate adenocarcinoma Quercetin (NPC20791) NP level
NCT04386304 Safety and Biomarker Response to (+)-Epicatechin in Becker Muscular Dystrophy Becker muscular dystrophy (+)-Epicatechin (NPC261619) NP level
NCT00569088 Study of the Pathogenesis and Molecular Mechanism of "YURE" in Internal Intractable Diseases stroke Mannitol (NPC86412) NP level
NCT04853199 Quercetin In The Treatment Of SARS-COV 2 COVID-19 Quercetin (NPC20791) NP level
NCT03236662 (-)- Epicatechin Becker Muscular Dystrophy Becker muscular dystrophy (-)-Epicatechin (NPC126029) NP level
NCT04217421 Cerebrum and Cardiac Protection With Allopurinol in Neonates With Critical Congenital Heart Disease Requiring Cardiac Surgery With Cardiopulmonary Bypass congenital heart disease Mannitol (NPC86412) NP level
NCT03636971 Gait Analysis Following Knee Viscosupplementation osteoarthritis Mannitol (NPC86412) NP level
NCT04474626 Isoquercetin in Sickle Cell Anemia sickle cell anemia Isoquercetin (NPC179950) NP level
NCT04534465 Study to Gather Information on the Acceptability of a New Flavor System With Increasing Levels of 2, 4, 6 g or Higher of Mannitol for PEG 3350 in Subjects Having Infrequent Bowel Movements. Constipation Mannitol (NPC86412) NP level
NCT00110136 St. John's Wort in Relieving Hot Flashes in Postmenopausal Women With Non-Metastatic Breast Cancer Breast Cancer|Hot Flashes Hypericum Perforatum Plant level
As single plant
NCT04648917 GASC1 Inhibitor Caffeic Acid for Squamous Esophageal Cell Cancer (ESCC) esophageal cancer Caffeic Acid (NPC294902) NP level
NCT04536090 Study of Isoquercetin (IQC-950AN) Plus Standard of Care Versus Standard of Care Only for the Treatment of COVID-19 COVID-19 Isoquercetin (NPC179950) NP level
NCT01485315 Transfusion-requirements in Septic Shock Trial septic shock Mannitol (NPC86412) NP level
NCT00351117 St. John's Wort in the Treatment of Raynaud's Phenomenon Raynaud's Disease Hypericum Perforatum Plant level
As single plant
NCT01028339 Mannitol vs HS to Treat ICHT After Severe TBI : Comparison on PtiO2 and Microdialysis Values brain injury Mannitol (NPC86412) NP level
NCT01375101 Therapeutic Effect of Quercetin and the Current Treatment of Erosive and Atrophic Oral Lichen Planus oral lichen planus Quercetin (NPC20791) NP level
NCT00303849 Carboplatin, Melphalan, Etoposide Phosphate, Mannitol, and Sodium Thiosulfate in Treating Patients With Previously Treated Brain Tumors anaplastic oligodendroglioma Mannitol (NPC86412) NP level
NCT03573999 Effect of Mannitol 20% Versus Hypertonic Saline 7.5% in Brain Metabolism and Oxygenation brain edema Mannitol (NPC86412) NP level
NCT00861978 St. John's Wort Extract LI 160 for the Treatment of Atypical Depression Atypical Depression Hypericum Perforatum Plant level
As plant Extract
NCT00251056 Mannitol Dose Response Study in Cystic Fibrosis cystic fibrosis Mannitol (NPC86412) NP level
NCT02446795 Isoquercetin as an Adjunct Therapy in Patients With Kidney Cancer Receiving First-line Sunitinib: a Phase I/II Trial renal cell carcinoma Isoquercetin (NPC179950) NP level
NCT05305508 Assessment of the Efficacy of Calcium Dobesilate vs. Placebo on SARS-CoV-2 Viral Load Amongst Outpatients With COVID-19. COVID-19 Mannitol (NPC86412) NP level
NCT05380635 PK and ECG Determinations Following 8 Weeks of HyBryte Treatment for Cutaneous T-Cell Lymphoma mycosis fungoides Hypericin (NPC227841) NP level
NCT02037815 Correlation of Measured and Calculated Serum Osmolality During Hyperosmolar Drugs Infusion in Patients After Craniotomy brain edema Mannitol (NPC86412) NP level
NCT04488874 Sodium Lactate and Brain Relaxation (LSD) intracranial hypertension Mannitol (NPC86412) NP level
NCT00455130 A Phase 2 Study to Determine the Safety and Efficacy of Inhaled Dry Powder Mannitol in Cystic Fibrosis cystic fibrosis Mannitol (NPC86412) NP level
NCT04907253 Quercetin in Coronary Artery By-pass Surgery coronary artery disease Quercetin (NPC20791) NP level
NCT02861898 Super-selective Intra-arterial Repeated Infusion of Cetuximab for the Treatment of Newly Diagnosed Glioblastoma brain cancer;glioblastoma multiforme Mannitol (NPC86412) NP level
NCT01720147 Quercetin in Children With Fanconi Anemia; a Pilot Study Fanconi anemia Quercetin (NPC20791) NP level
NCT01708278 Beneficial Effects of Quercetin in Chronic Obstructive Pulmonary Disease (COPD) chronic obstructive pulmonary disease Quercetin (NPC20791) NP level
NCT04946383 Safety and Effectivness of Quercetin & Dasatinib on Epigenetic Aging aging Quercetin (NPC20791) NP level
NCT05276895 Effect of Natural Senolytic Agents & NLRP3 Inhibitors on Osteoarthritis osteoarthritis Quercetin (NPC20791);Fisetin (NPC51443) NP level
NCT03223272 Mechanisms of Refractory Hypertension (Reserpine) hypertension Reserpine (NPC88923) NP level
NCT00189007 Antenatal Allopurinol During Fetal Hypoxia fetal hypoxia Mannitol (NPC86412) NP level
NCT00131885 Effects of St. John's Wort on the Oral Contraceptive Hormone Levonorgestrel Contraception Hypericum Perforatum Plant level
As single plant
NCT04853082 Limonene on Regulating Metabolism-related Fatty Liver Disease (MAFLD) and Analysis of TCM Constitution Hepatic steatosis Limonene (NPC76145) NP level
NCT01606787 Mannitol Use During Partial Nephrectomy Prior to Renal Ischemia and Impact on Renal Function Outcomes kidney cancer Mannitol (NPC86412) NP level
NCT00446680 Long Term Administration of Inhaled Dry Powder Mannitol In Cystic Fibrosis - A Safety and Efficacy Study cystic fibrosis Mannitol (NPC86412) NP level
NCT00118833 St. John's Wort for the Treatment of Generalized Social Anxiety Disorder (GSAD) Anxiety Disorders|Mental Health Hypericum Perforatum Plant level
As single plant
NCT01520207 Mannitol - Potential Role in Hemodialysis Initiation for Reduction of Intra-dialytic Hypotension hypotension Mannitol (NPC86412) NP level
NCT00359697 Comparison of Two Different Medications Used to Treat Elevated Intracranial Pressure intracranial hypertension Mannitol (NPC86412) NP level
NCT05456022 Therapeutic Efficacy of Quercetin Versus Its Encapsulated Nanoparticle on Tongue Squamous Cell Carcinoma Cell Line mouth neoplasm Quercetin (NPC20791) NP level
NCT03751592 Phase Ib/IIa Studies of Chlorogenic Acid for Injection for Safety and Efficacy of Advanced Lung Cancer lung cancer Chlorogenic Acid (NPC302857) NP level
NCT02656212 Early Phase Pre-Clinical and Initial Clinical Research on Epicatechin (Part 2) prediabetes syndrome (+)-Epicatechin (NPC261619) NP level
NCT04537299 COVID-FIS: Pilot in COVID-19 (SARS-CoV-2) of Fisetin in Older Adults in Nursing Homes COVID-19;severe acute respiratory syndrome Fisetin (NPC51443) NP level
NCT00005805 St. John's Wort in Relieving Fatigue in Patients Undergoing Chemotherapy or Hormone Therapy for Cancer Chronic Myeloproliferative Disorders|Fatigue|Leukemia|Lymphoma|Multiple Myeloma and Plasma Cell Neoplasm|Myelodysplastic Syndromes|Precancerous Condition|Unspecified Adult Solid Tumor;Protocol Specific Hypericum Perforatum Plant level
As single plant
NCT02448381 FLASH [Fluorescent Light Activated Synthetic Hypericin] Clinical Study: Topical SGX301 (Synthetic Hypericin) for the Treatment of Cutaneous T-Cell Lymphoma (Mycosis Fungoides) Cutaneous T-cell lymphoma Hypericin (NPC227841) NP level
NCT04870073 Retrograde Autologous Priming and Mannitol for Reducing Hemodilution in Cardiac Surgery coronary artery disease Mannitol (NPC86412) NP level
NCT02351622 Caffeic Acid Tablets as a Second-line Therapy for ITP autoimmune thrombocytopenic purpura Caffeic Acid (NPC294902) NP level
NCT05422885 Safety and Feasibility of Dasatinib and Quercetin in Adults at Risk for Alzheimer's Disease aging Quercetin (NPC20791) NP level
NCT00446667 A Pilot Safety Study of Inhaled Dry Powder Mannitol in Acute Exacerbations of COPD chronic obstructive pulmonary disease Mannitol (NPC86412) NP level
NCT04394143 Effect of AD128 to Treat Obstructive Sleep Apnea obstructive sleep apnea Mannitol (NPC86412) NP level
NCT00277537 Safety and Efficacy of Bronchitol in Bronchiectasis Bronchiectasis Mannitol (NPC86412) NP level
NCT05062486 A Study to Evaluate the Safety and Efficacy of RQC for AMD age-related macular degeneration Quercetin (NPC20791) NP level
NCT05432284 Behavioral Pharmacology of THC and Beta-Myrcene cannabis dependence Myrcene (NPC138113) NP level
NCT01843088 Trial of Mannitol Cream for Pain Relief After a Long Run pain Mannitol (NPC86412) NP level
NCT01887197 Repeatability and Response Study of Absorptive Clearance Scans cystic fibrosis Mannitol (NPC86412) NP level
NCT01718964 Acute Effects of Cortisol on Heroin Craving in Opioid Dependence (Ghost-Basel) opioid dependence Mannitol (NPC86412) NP level
NCT02728349 Tolerance and Pharmacokinetic Study of Chlorogenic Acid to Advanced Glioblastoma glioblastoma multiforme Chlorogenic Acid (NPC302857) NP level
NCT02226484 Can Quercetin Increase Claudin-4 and Improve Esophageal Barrier Function in GERD? gastroesophageal reflux disease Quercetin (NPC20791) NP level
NCT00113854 Mannitol as Adjunct Therapy for Childhood Cerebral Malaria malaria Mannitol (NPC86412) NP level
NCT01856868 Use of (-)-Epicatechin in the Treatment of Becker Muscular Dystrophy (Pilot Study) Becker muscular dystrophy (-)-Epicatechin (NPC126029) NP level
NCT00330096 Effects of Hesperidin on Bone Mineral Density and Bone Metabolism of Postmenopausal Women osteoporosis Hesperidin (NPC79056) NP level
NCT00000514 Systolic Hypertension in the Elderly Program (SHEP) cerebrovascular disorder;heart disease;hypertension Reserpine (NPC88923) NP level
NCT01690676 Effect of an Apple Polyphenol Extract on Brachial Artery Flow-mediated Vasodilatory Function hypertension (+)-Epicatechin (NPC261619) NP level
NCT00117208 Comparison of Inhaled Mannitol and rhDNase in Children With Cystic Fibrosis cystic fibrosis Mannitol (NPC86412) NP level
NCT01880866 (-)-Epicatechin and Pulmonary Arterial Hypertension pulmonary arterial hypertension (-)-Epicatechin (NPC126029) NP level
NCT01438320 Q-Trial in Patients With Hepatitis C chronic hepatitis C virus infection Quercetin (NPC20791) NP level
NCT05416515 A Study of Fisetin to Treat Carpal Tunnel Syndrome carpal tunnel syndrome Fisetin (NPC51443) NP level
NCT01663922 Boceprevir and Ucalm (St John&Apos;s Wort) Hepatitis C Hypericum Perforatum Plant level
As single plant
NCT04770064 Targeting Senescence to Reduce Osteoarthritis Pain and cartilagE Breakdown (ROPE) osteoarthritis, knee Fisetin (NPC51443) NP level
NCT01839344 Effects of Quercetin on Blood Sugar and Blood Vessel Function in Type 2 Diabetes. type 2 diabetes mellitus Quercetin (NPC20791) NP level
NCT03758014 Studies of Chlorogenic Acid for Injection for Safety and Efficacy of Grade IV GBM Patients glioblastoma multiforme Chlorogenic Acid (NPC302857) NP level
NCT00026013 Effects of St. John's Wort on the Effectiveness of Oral Contraceptives Contraception Hypericum Perforatum Plant level
As single plant
NCT00000541 Women's Antioxidant and Folic Acid Cardiovascular Study (WAFACS) myocardial infarction;Myocardial Ischemia Beta Carotene (NPC17810) NP level
NCT05442190 Topical SGX302 for Mild-to-Moderate Psoriasis psoriasis vulgaris Hypericin (NPC227841) NP level
NCT05022108 Alpha-Bisabolol Gel With Antihistamine Action injury Alpha-Bisabolol (NPC157781) NP level
NCT00006395 Drug Interaction Study of Tegretol (Carbamazepine) and St. John's Wort in Normal Volunteers Healthy Hypericum Perforatum Plant level
As single plant
NCT04210986 Senolytic Drugs Attenuate Osteoarthritis-Related Articular Cartilage Degeneration: A Clinical Trial osteoarthritis, knee Fisetin (NPC51443) NP level
NCT00000620 Action to Control Cardiovascular Risk in Diabetes (ACCORD) atherosclerosis;coronary artery disease;Hypercholesterolemia;type 2 diabetes mellitus;hypertension Reserpine (NPC88923) NP level
NCT00066859 Sertraline Compared With Hypericum Perforatum (St.John's Wort) in Treating Depression Depression|Unspecified Adult Solid Tumor;Protocol Specific Hypericum Perforatum Plant level
As single plant
NCT05129748 Efficacy of Sodium Thiosulfate and Mannitol in Reducing Ototoxicity in Adult Patients Receiving Cisplatin Chemotherapy hearing loss Mannitol (NPC86412) NP level
NCT02964377 Plus Epicatechin Duchenne Muscular Dystrophy in Non-ambulatory Adolescents Duchenne muscular dystrophy (+)-Epicatechin (NPC261619) NP level
NCT00000792 A Pharmacologically Guided Phase I/II Study of Daily Orally Administered Synthetic Hypericin in HIV-Infected Subjects HIV infection Hypericin (NPC227841) NP level
NCT00000161 Randomized Trials of Vitamin Supplements and Eye Disease cataract;macular degeneration Beta Carotene (NPC17810) NP level
NCT04514510 Fixed Dose Flavonoid Isoquercetin on Thrombo-Inflammatory Biomarkers in Subjects With Stable Sickle Cell Disease sickle cell anemia Isoquercetin (NPC179950) NP level
NCT04622865 Masitinib Combined With Isoquercetin and Best Supportive Care in Hospitalized Patients With Moderate and Severe COVID-19 COVID-19 Isoquercetin (NPC179950) NP level
NCT00000499 Systolic Hypertension in the Elderly Program (SHEP) (Pilot Study) heart disease;hypertension Reserpine (NPC88923) NP level
NCT04851821 The Effectiveness of Phytotherapy in SARS-COV2(COVID-19) COVID-19 Quercetin (NPC20791) NP level
NCT00669331 Inhaled Mannitol as a Mucoactive Therapy for Bronchiectasis Bronchiectasis Mannitol (NPC86412) NP level
NCT01705652 Study to Assess the Activity of Nexrutine® in Prostate Cancer Patients prostate cancer Rutin (NPC176740) NP level
NCT02245204 Phase I Studies of Chlorogenic Acid for Injection for Tolerance and Pharmacokinetic of Advanced Cancers cancer Chlorogenic Acid (NPC302857) NP level
NCT02330276 Early Phase Pre-Clinical and Initial Clinical Research on Epicatechin prediabetes syndrome (+)-Epicatechin (NPC261619) NP level
NCT00267657 A Phase 1 Parallel-Group, Double-Blind, Placebo-Controlled Cardiovascular and Behavioral Study Assessing Interactions Between Single Doses of Oral Reserpine and Intravenous Methamphetamine - 1 methamphetamine dependence Reserpine (NPC88923) NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
 ❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Pain, unspecified
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG3Z
 MTOR,OPRD1,ACHE,BCHE,ALOX5,IGF1R,AKR1B1,CNR2
 NCT01843088
Pulmonary hypertension
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BB01
 MTOR,SLC18A2
 NCT00000499,NCT02684786,NCT00000514,NCT01880866,NCT00000620,NCT01690676,NCT03223272
West Nile virus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D46
 ACHE,NFKB1,CYP19A1,GPR84,BTN3A1,CBR1,MET,AXL,DPP4
Malignant haematopoietic neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B33
 CDK1,FLT3,DPP4,KDM1A,TP53,SRC,MTOR,AURKB
Multiple myeloma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A83
 DRD3,AHR,IGF1R,FLT3,KDR,AXL,MTOR,SRC
Pancreatic cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10
 SRC,MMP1,FDPS,MTOR,MMP2,TP53,IGF1R,EGFR
Rheumatoid arthritis
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA20
 OPRD1,MMP1,ALOX5,NFKB1,CA2,MMP9,ABCG2,AKR1B1
Other specified malignant neoplasms ofcolon
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B90.Y
 CYP1A1,OPRD1,MMP1,SLCO1B1,TYR,NOX4,MET,NPSR1
Melanoma of skin
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30
 NR1I2,NOX4,APP,ABCG2,GPR84,CDK6,BTN3A1,IGF1R
Superficial ovarian endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10.B4
 ACHE,SNCA,LMNA,PGAM1,CA4,CA2,SRC,DPP4
Chikungunya virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D40
 LMNA,MMP2,CYP19A1,EGFR,SLC22A2,GPR84,XDH,AXL
Depression
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A70-6A7Z
 MAOA,CRHR1,DRD3,LINC02210-CRHR1
 NCT00861978,NCT05477472,NCT00066859
Renal cell carcinoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90
 MMP2,KDR,MET,EGFR,MMP9,MTOR
 NCT02446795
Myelodysplastic syndrome
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A37
 FDPS,AXL,KDM1A,EGFR,TP53,AHR,KDR
Psoriasis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA90
 NFKB1,CDK6,FLT3,ALOX5,AHR,DPP4
 NCT05442190
Colorectal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B91
 FDPS,FLT3,EGFR,TP53,IGF1R,MET,KDR
Crohn disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD70
 MMP9,CNR2
 GPR84,ALPL,MMP1,MMP9
 NCT00275418
Osteoarthritis, unspecified
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA0Z
 CA12,ALPL,MMP2,HSD17B2,MMP9,CDK6,CDK1
Malignant neoplasm metastasis in lymph nodes of head, face or neck
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D60.0
 NOX4,MMP9,SLCO1B1,BCHE,MMP1,AURKB,NPSR1
Other specified malignant neoplasms of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.Y
 CA12,MMP9,AURKB,XDH,MMP1,CDK1,CCNB2
Unspecified malignant neoplasms of unspecified sites
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D4Z
 NCT00066859,NCT00041171,NCT00041171
 NCT02136342,NCT04733534,NCT02245204
Type 2 diabetes mellitus
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A11
 GPR84,DPP4,NFKB1
 NCT01921881
 NCT01839344,NCT00000620
Stomach cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72
 TP53,EGFR,KDR,DRD3,MET,MMP9
Bacterial infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A00-1C4Z
 ABCB1,CA4,CA2,CA14,CYP2C9,CA12
Liver cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12
 MTOR,KDR,MET,EGFR,IGF1R,CSNK2A1
Parkinsonism
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A00
 GSK3B,SNCA,ACHE,SRC,DRD3,MAOA
Carpal tunnel syndrome
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C10.0
 NOX4,MMP2,CYP1B1,ESR1,DPP4
 NCT05416515
Anxiety
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MB24.3
 CYP3A4,CRHR1,OPRD1,LINC02210-CRHR1
 NCT00118833
Ovarian cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73
 TP53,FLT3,KDR,SRC,MET
Prostate cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82
 MAOA,MTOR,AURKB,ESR1
 NCT01705652
Glaucoma
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9C61
 AKR1B1,CA2,CA4,MET,ACHE
Atopic eczema
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA80
 NFKB1,AHR,ALOX5,CNR2,CYP3A4
Myeloproliferative neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A20
 FLT3,KDM1A,SRC,GSK3B,FDPS
Head and neck cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D42
 EGFR,MET,TP53,MTOR,KDR
Mature T-cell lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A90
 KDM1A,EGFR,DRD3,MTOR,FDPS
Inflammatory bowel diseases, unspecified
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD7Z
 ALPL,NOX4,MMP9,GPR84,MMP1
Dengue fever, unspecified
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D2Z
 NR1I2,MAOA,ABCG2,DRD3,AURKB
Human immunodeficiency virus disease without mention of tuberculosis or malaria
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1C62
 GPR84,FLT3,MET,AXL,CNR2
Irritable bowel syndrome
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD91
 OPRD1,NFKB1,ABCG2
 NCT00587860
Acute diabete complication
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A2Y
 DPP4,AKR1B1,AURKB,KDR
Mature B-cell leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A82
 AXL,TP53,EGFR,SRC
Multiple sclerosis
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A40
 ESR1,SRC,NFKB1
 GPR84
Substance abuse
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C40
 MAOA,ACHE,CRHR1,LINC02210-CRHR1
Melanoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30
 KDR,EGFR,TYR,MET
Nasopharyngeal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B6B
 CDK1,EGFR,DRD3,ALOX5
Chronic pain
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG30
 FLT3,KDR,OPRD1,EGFR
Chronic kidney disease
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GB61
 IGF1R,XDH
 NCT02848131,NCT02552888
Endometrial cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76
 DRD3,MTOR,SRC,TP53
Peritoneal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C51
 KDR,TP53,SRC,FLT3
Pleomorphic sarcoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B54
 MTOR,MET,SRC,KDR
Metastatic lymph node neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D60
 MET,KDR,MTOR,EGFR
Unspecific body region injury
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: ND56
 MET,EGFR
 NCT05022108,NCT00810940
Bronchiectasis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA24
 NCT00669331,NCT00730977,NCT00277537,NCT01076491
coronary artery disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA8Y-BA8Z
 NCT04907253,NCT03943459,NCT00000620,NCT04870073
Adenocarcinoma of prostate
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82.0
 NOX4,SLCO1B1,ALOX15
 NCT01912820
Chronic rhinosinusitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA0A
 CYP1A1,MMP9,GPR84,MMP1
Systemic lupus erythematosus
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40.0
 ACHE,CYP1A1,MMP9,YES1
Ebola virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D60.01
 HSD17B2,ACHE,MET,AXL
Mesothelioma of pleura
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C26.0
 KDR,SNCA,OPRD1,MMP1,ALOX15,CSNK2A2,CA7,AURKB,XDH,TYR,CBR1,RECQL,ALPI,DPP4,PIM1,ABCB1,LMNA,SMN1,AHR,HSD17B2,EGFR,APEX1,BTN3A1,CDK1,CRHR1,CNR2,CA12,ALOX5,MMP9,GPR84,BCHE,CDK6,TDP1,FLT3,SRC,MET,AXL
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 ACHE,NR1I2,SNCA,CA2,MMP1,ALOX15,CYP2C19,CA7,CDK5R1,ABCG2,AURKB,XDH,POLB,CBR1,RECQL,ALPI,DPP4,PIM1,ABCB1,PGAM1,LMNA,MMP2,CISD1,HSD17B2,CYP1B1,CYP2C9,CRHR1,CNR2,APP,ALOX5,CA14,GPR84,BCHE,MET,AXL,NPSR1
Diffuse large B-cell lymphomas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 ACHE,NR1I2,KDR,HSD17B10,MMP1,AKR1B1,KDM1A,CSNK2A2,CCNB2,CDK5R1,AURKB,CBR1,RECQL,PSMB1,NOX4,LMNA,MMP2,SMN1,CISD1,AHR,EGFR,CSNK2A1,APEX1,CDK1,FDPS,CNR2,CA12,TSHR,TP53,CDK6,TDP1,SRC,MET,AXL
Germ cell tumour of testis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C80.2
 ACHE,KDR,SNCA,OPRD1,MMP1,AKR1B1,CA4,ABCG2,SLC18A2,SLCO1B1,XDH,ALPI,DPP4,PGAM1,NOX4,MMP2,SMN1,AHR,ALOX12,HSD17B2,CYP2C9,BTN3A1,CDK1,CRHR1,CNR2,CA12,APP,ALOX5,CA14,GPR84,BCHE,CDK6,MET,NPSR1
Solid tumour/cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00-2F9Z
 CDK1,CDK6,CA4,NFKB1,IGF1R,AXL,YES1,CYP3A4,XDH,AURKB,AHR,ESR1,PIM1,EGFR,CA14,FLT3,APP,DRD3,KDR,MTOR,MET,POLB,ALOX5,MMP9,TP53,APEX1,KDM1A,CA12,CA2,ABCB1,GSK3B,CSNK2A1,SRC
Attention deficit hyperactivity disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A05
 DRD3,CNR2
 NCT00100295
Non-small cell lung cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25
 EGFR,MET,KDR
Retinopathy
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9B71
 APP,IGF1R,APEX1
Thyroid cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D10
 KDR,MET,TSHR
Asthma
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA23
 CBR1,CA4,ALOX5
Seborrhoeic dermatitis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA81
 CA4,CA12,CA2
Schizophrenia
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A20
 AKR1B1,DRD3,CDK6
Low bone mass disorder
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FB83
 ESR1,CA2,FDPS
Ischemic heart disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA40-BA6Z
 MET
 NCT00000514,NCT00000499
Thrombocytopenia
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3B64
 KDR,AHR,ALOX5
Cardiovascular disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA00-BE2Z
 KDR,MET,SRC
Idiopathic interstitial pneumonitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CB03
 ALOX5,FLT3,GPR84
Diabetes mellitus, type unspecified
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A14
 ESR1,DPP4,NFKB1
Pituitary gland disorder
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A60-5A61
 ALOX5,IGF1R,ESR1
Chronic arterial occlusive disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD4Z
 MET,DPP4,TP53
BCR-ABL1-negative chronic myeloid leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A41
 DRD3,FLT3,SRC
Macular degeneration
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9B75
 NCT05062486,NCT00000152,NCT00000161
Glioblastoma, primary, NOS
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH0MB1
 NCT02861898,NCT03758014,NCT02728349
Osteoarthritis of knee
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA01
 NCT04815902,NCT04210986,NCT04770064
Becker muscular dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C70.0
 NCT01856868,NCT03236662,NCT04386304
Chronic obstructive pulmonary disease
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA22
 NCT01708278,NCT00446667,NCT03989271
Coeliac disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA95
 CDK1,CYP1A1,TSHR
Myelodysplastic syndromes, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A3Z
 PIM1,CYP2C9,TSHR
Tetralogy of Fallot
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LA88.2
 CA4,ABCG2,CA14
Gliomas of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.0
 NOX4,AHR,MMP9
Carcinosarcoma of uterus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.43
 NR1I2,CA2,HSD17B10,OPRD1,CYP19A1,MMP1,AKR1B1,KDM1A,ALOX15,CA7,ALPL,CDK5R1,XDH,POLB,DPP4,PGAM1,CISD1,HSD17B2,YES1,TSHR,TP53,CA14,MMP9,GPR84,CDK6,TDP1,MET,AURKB,NPSR1
Serous cystadenoma,borderline malignancy of ovary
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73.4
 NR1I2,CA2,OPRD1,MMP1,ALOX15,ALPL,XDH,ALPI,NOX4,CISD1,AHR,ALOX12,HSD17B2,CSNK2A1,APEX1,YES1,CRHR1,FDPS,CYP1A2,CA12,TSHR,ALOX5,CSNK2A3,TP53,MMP9,ESR1,GPR84,TDP1,MET
Other specified malignant neoplasms of kidney, except renal pelvis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90.Y
 ACHE,OPRD1,CYP19A1,CCNB2,XDH,TYR,CYP2C9,ALOX5,MMP9,GPR84,BCHE,MET,AURKB,TSHR,ALOX5,OPRD1,MMP9,GPR84,AURKB,MMP1,BTN3A1,ALPI,CCNB2
Malignant neoplasms of biliary tract, distal bile duct
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C15
 MMP1,AKR1B1,CCNB2,CDK5R1,CA4,NOX4,LMNA,MMP2,ALOX12,CSNK2A1,BTN3A1,CDK1,CRHR1,ALOX5,CSNK2A3,TP53,MMP9,GPR84,SRC,IGF1R,AURKB
Hepatocellular carcinoma of liver
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.02
 CA12,CDK5R1,NOX4,CA4,MMP9,CYP19A1,AURKB,MMP1,CDK1,ALPI,CCNB2,CA12,FDPS,MMP9,CYP19A1,AURKB,MMP1,CDK1,SRC,ALPI,CCNB2
Malignant neoplasms of thymus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C27
 ACHE,HSD17B10,NFKB1,AKR1B1,ALOX15,CDK5R1,SLC18A2,CYP3A4,DPP4,PSMB1,CISD1,HSD17B2,CYP1B1,CYP2C9,APEX1,CRHR1,FDPS,CNR2,MMP9,FLT3
Malignant neoplasms of kidney, except renal pelvis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90
 NCT00041171
 NCT01606787
Chronic hepatitis C
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1E51.1
 NCT01663922
 NCT01438320
Cataract
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9B10
 AKR1B1
 NCT00000161
Ischaemic/haemorrhagic stroke
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B20
 MMP9
 NCT00569088
Fallopian tube cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C74
 SRC,TP53
Mild neurocognitive disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6D71
 ACHE,BCHE
Motor neuron disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B60
 IGF1R,SRC
Ischemia
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B10-8B11
 SRC,EGFR
Fungal infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F29-1F2F
 NFKB1,ALOX5
Colon cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B90
 ALPL,EGFR
Neuropathy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C0Z
 CYP19A1,AKR1B1
Insomnia
Disease Category: 07.Sleep-wake disorders
Disease ICD-11 Code: 7A00-7A0Z
 CA2,CNR2
NA
Disease Category: NA
Disease ICD-11 Code: NA
 MET,NOX4
Influenza
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1E30-1E32
 XDH,ALOX5
Malignant digestive organ neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C11
 KDR,SRC
Opioid use disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C43
 OPRD1
 NCT01718964
Cervical cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C77
 TP53,SRC
Essential hypertension
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA00
 CA2,SLC18A2
Acquired hypomelanotic disorder
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED63
 MAOA,TYR
Esophageal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B70
 TP53
 NCT04648917
Postoperative inflammation
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A00-CA43
 SRC,ALOX5
Choreiform disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A01
 NFKB1,SLC18A2
Gastrointestinal stromal tumour
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B5B
 SRC,KDR
General pain disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8E43
 MAOA,CNR2
Adrenogenital disorder
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A71
 CRHR1,LINC02210-CRHR1
Chronic myelomonocytic leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A40
 MTOR,FLT3
Osteosarcoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B51
 GSK3B,SRC
Bladder cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94
 MTOR,TP53
Unspecified viral infection of unspecified site
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D9Z
 ESR1,FLT3
Endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10
 ESR1,CYP19A1
Malignant mesenchymal neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B5D-2B5Y
 EGFR,MTOR
Heart failure
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD10-BD1Z
 CA2,XDH
Transplant rejection
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: NE84
 TP53,MTOR
Mature B-cell lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A85
 CDK1,FLT3
Acne vulgaris
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED80
 MMP2,ESR1
Myocardial infarction
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA41-BA43
 DPP4
 NCT00000541
Muscular atrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B61
 SMN2,SMN1
Staphylococcal/streptococcal disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1B5Y
 LINC02210-CRHR1,CRHR1
Human immunodeficiency virus disease without mention of associated disease or condition, clinical stage unspecified
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1C62.Z
 NCT00000645,NCT00000792
Intermediate hyperglycaemia, unspecified
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A40.Z
 NCT02656212,NCT02330276
Sickle-cell disorder
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3A51
 NCT04474626,NCT04514510
Cerebral oedema
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8D60.1
 NCT02037815,NCT03573999
Other specified increased intracranial pressure
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8D60.Y
 NCT04488874,NCT00359697
Ageing associated decline in intrinsic capacity
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG2A
 NCT04946383,NCT05422885
Osteoarthritis
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA00-FA05
 NCT05276895,NCT03636971
Zika virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D48
 ACHE,AXL
Myotonic dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C71.0
 CYP1A1,CHRNE
Pneumonia due to Pseudomonasaeruginosa
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA40.05
 MMP9,DPP4
Systemic sclerosis
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A42
 NOX4,MMP1
Heart failure, unspecified
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD1Z
 ABCG2,CYP1B1
Malaria, unspecified
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F4Z
 GPR84,MMP9
Lyme borreliosis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1C1G
 MET,MMP9
Adenocarcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.0
 ACHE,NR1I2,OPRD1,MMP1,CCNB2,CA7,CDK5R1,SLCO1B1,XDH,CBR1,CYP2C9,CDK1,CRHR1,CA12,TSHR,MMP9,GPR84,AURKB,NPSR1
Breast cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C60-2C6Y
 SRC,MTOR,MET,AXL,CDK6,CDK1,EGFR,KDR,CA14,CA2,IGF1R,CYP19A1,CA12,ESR1,CA4
 NCT00110136,NCT00041171
Squamous cell carcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.2
 MMP1,CCNB2,CA7,CDK5R1,SLCO1B1,XDH,CBR1,ALOX12,CYP2C9,CDK1,CRHR1,CA12,TSHR,MMP9,SLC22A2,AURKB,NPSR1
Malignant neoplasms of adrenal gland
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D11
 SNCA,CYP19A1,MMP1,CCNB2,CA7,CA4,CYP3A4,CBR1,DPP4,NOX4,HSD17B2,CDK1,CA12,MMP9,BCHE,MET,AURKB
Lung cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25
 FLT3,AXL,ALOX5,MMP2,ABCB1,CDK6,CDK1,IGF1R,KDM1A,MMP1,MMP9,EGFR,MTOR,MET,KDR
 NCT03751592
Pheochromocytoma
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH3854
 ACHE,SNCA,CA2,OPRD1,MMP1,CDK5R1,CA4,SLC18A2,XDH,NOX4,CRHR1,APP,CA14,MMP9,BCHE,MET
Hepatoblastoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.01
 OPRD1,CYP19A1,MMP1,AKR1B1,CCNB2,CDK5R1,CA4,NOX4,MMP2,CDK1,CA12,MMP9,CDK6,SRC,IGF1R,AURKB
Malignant neoplasms of corpus uteri, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.Z
 CA2,CYP1A1,MMP1,ALOX15,CCNB2,ALPL,AURKB,XDH,ALPI,HSD17B2,CYP2C9,CDK1,MMP9,GPR84,NPSR1
Adenocarcinoma of stomach
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72.0
 CYP19A1,MMP1,ALOX15,CCNB2,SLCO1B1,NOX4,CDK1,MMP9,GPR84,CDK6,MET,AURKB,NPSR1
Cytomegaloviral disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D82
 ACHE,KDM4E,CDK5R1,CA2,ABCB1,CYP1A1,OPRD1,CA14,MMP9,CYP2C9,ALOX15,CYP2C19,CNR2
Brain cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00
 DRD3,KDR,SRC,MMP9,EGFR,MET,TP53,MMP2,ESR1,MMP1,CDK6
 NCT02861898
Leishmaniasis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F54
 MMP1,AKR1B1,ALPL,DPP4,NOX4,MMP2,BTN3A1,CNR2,TSHR,MMP9,GPR84,FLT3
Malignant neoplasms of oesophagus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B70
 ACHE,ALOX15,NOX4,MMP9,SLCO1B1,GPR84,AURKB,MMP1,CDK1,ALPI,CCNB2,NPSR1
Urothelial carcinoma of bladder
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94.2
 CA2,MMP9,SLCO1B1,GPR84,CYP3A4,CYP2C9,MMP1,AKR1B1,AURKB,CDK1,CCNB2,CYP1A2
Malignant neoplasms of thyroid gland, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D10.Z
 CA12,ALPL,NOX4,CA7,SLC18A2,DPP4,GABRA6,ALOX5,CYP1B1,XDH,MMP1,MET
Glioblastoma of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.00
 KDR,CA2,CYP19A1,DPP4,LMNA,CYP1B1,CA12,TSHR,CSNK2A3,GPR84,MET
Acute myeloid leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A60
 AURKB,NFKB1,PIM1,TP53,FDPS,FLT3,SRC,KDM1A,GSK3B,AXL
Alzheimer disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A20
 ACHE,BCHE,APP,FLT3,MAOA,SLC18A2,MET,DRD3,KDR,SNCA
COVID-19
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D6Y
 NCT04622865,NCT04771611,NCT04536090,NCT05305508,NCT04537299,NCT04476953,NCT04851821,NCT04733651,NCT04853199,NCT04385264
Cystic fibrosis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA25
 NCT00792714,NCT01887197,NCT00251056,NCT00117208,NCT01348204,NCT01883531,NCT00455130,NCT02134353,NCT00630812,NCT00446680
Invasive carcinoma of breast
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C61
 CA12,OPRD1,MMP9,ESR1,GPR84,AURKB,MMP1,CDK1,CCNB2,CNR2
Renal cell carcinoma, chromophobe type
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH6153
 CA2,CYP1A1,CCNB2,CDK5R1,SLC18A2,CYP3A4,CYP1A2,CA12,MET,AURKB
Acute ischaemic heart disease, unspecified
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA4Z
 NCT01330589
Flare or flash
Disease Category: X.Extension Codes
Disease ICD-11 Code: XE03F
 NCT00110136
Psychostimulants, ADHD and nootropic agents
Disease Category: X.Extension Codes
Disease ICD-11 Code: XM12M9
 NCT00782080
Malignant neoplasms of peripheral nerves or autonomic nervous system, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C4Z
 NCT00041171
Malignant neoplasm metastasis in thoracic or respiratory organs, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D7Z
 NCT00041171
Primary Raynaud disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD42.0
 NCT00351117
Biliary tract cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C17
 MET
Tic disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A05
 SLC18A2
Bone/articular cartilage neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2F7B
 FLT3
Ulcerative colitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD71
 MMP9
Synovial sarcoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B5A
 SRC
Hypopharyngeal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B6D
 EGFR
Encephalopathy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8E47
 XDH
Lymphangioleiomyomatosis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CB07
 MTOR
Cough
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MD12
 OPRD1
Mineral excesses
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B91
 FDPS
Metastatic biliary tract neoplasms
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C14-2C17
 EGFR
Angina pectoris
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA40
 EGFR
Functional bladder disorder
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GC50
 OPRD1
Metastatic liver/bile duct neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D80
 TP53
Ewing sarcoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B52
 KDM1A
Kidney failure
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GB60-GB6Z
 TP53
Arteries/arterioles disorder
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD52
 MTOR
Movement disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A07-8A0Z
 SLC18A2
Hepatic fibrosis/cirrhosis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB93
 MMP2
Migraine
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A80
 OPRD1
Diagnostic imaging
Disease Category: NA
Disease ICD-11 Code: N.A.
 APP
Indeterminate colitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD72
 NFKB1
Desmoid tumour
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2F7C
 APP
Acquired hypermelanosis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED60
 TYR
Transplanted organ/tissue
Disease Category: 24.Factors influencing health status or contact with health services
Disease ICD-11 Code: QB63
 FLT3
Duodenal ulcer
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA63
 CA2
Psychoactive substances use disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C4G
 DRD3
Hepatitis virus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1E50-1E51
 EGFR
Genetic prion disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8E02
 ALPL
Cushing syndrome
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A70
 CYP19A1
Skin and skin-structure infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F28-1G0Z
 NFKB1
Focal/segmental autonomic disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8D8A
 FDPS
Myotonic disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C71
 GSK3B
Leiomyosarcoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B58
 SRC
Parasitic infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D0Y-1G2Z
 ALPL
Pleural mesothelioma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C26
 MTOR
Eexposure to noxious substances harmful effect
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: NE61
 BCHE
Dementia
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6D80-6D8Z
 ACHE
Female pelvic pain
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA34
 ESR1
Dystonic disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A02
 SLC18A2
Bowel habit change
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: ME05
 OPRD1
Dyspareunia
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA12
 ESR1
Ovarian dysfunction
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A80
 TP53
Sexual dysfunction
Disease Category: 17.Conditions related to sexual health
Disease ICD-11 Code: HA00-HA01
 DRD3
Menopausal disorder
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA30
 ESR1
Ureteral cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C92
 AHR
Dissociative neurological symptom disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6B60
 SLC18A2
Bipolar disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A60
 DRD3
Diabetic foot ulcer
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD54
 EGFR
Phakomatoses/hamartoneoplastic syndrome
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LD2D
 FLT3
Inborn metabolism deficiency
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C50-5C59
 CA14
Liver disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB90-DB9Z
 MET
Acquired prion disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8E01
 ESR1
Tonus and reflex abnormality
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MB47
 BCHE
Dystrophic epidermolysis bullosa
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EC32
 APP
Acute/subacute hepatic failure
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB91
 NFKB1
Musculoskeletal system/connective tissue disease
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FC0Z
 FDPS
Bone paget disease
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FB85
 FDPS
Hyper-lipoproteinaemia
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C80
 ESR1
Mood disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A60-6E23
 MAOA
Amyloidosis
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5D00
 APP
Mineral deficiency
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B5K
 XDH
Muscular dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C70
 NFKB1
Menstrual cycle bleeding disorder
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA20
 ESR1
Mastocytosis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A21
 FLT3
Metabolic disorder
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C50-5D2Z
 DPP4
Myasthenia gravis
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C6Y
 ACHE
Urethral cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C93
 EGFR
Inborn purine/pyrimidine/nucleotide metabolism error
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C55
 XDH
Hypo-thyroidism
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A00
 TSHR
Female genital tract noninflammatory disorder
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA1Y
 ESR1
Inflammatory arthropathy
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA2Z
 FLT3
Hydrocephalus
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8D64
 MTOR
Coronary vasospastic disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA85
 OPRD1
Metastatic malignant neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D50-2E09
 AXL
Female infertility
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA31
 ESR1
Vaginitis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA02
 ESR1
Gout
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA25
 XDH
Pediculosis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1G00
 ACHE
Skin postprocedural disorder
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EL8Y
 EGFR
Lupus erythematosus
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40
 NFKB1
Epidermal dysplasias
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EK90
 SRC
Parasitic worm infestation
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F90
 ACHE
Human immunodeficiency virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1C60-1C62
 FLT3
Extraocular muscle disorder
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9C82
 IGF1R
Fragile X chromosome
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LD55
 GSK3B
Thrombosis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB61-GB90
 AKR1B1
Spinal pain
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: ME84
 OPRD1
Coronavirus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D92
 CSNK2A1
Filariasis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F66
 ALOX5
Autism spectrum disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A02
 DPP4
Diffuse large B-cell lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 FLT3
Autonomic nervous system disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8D87
 SNCA
Breast in situ carcinoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2E65
 ESR1
Spinal cord/cranial nerve neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A02
 EGFR
Metastatic tumour
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D50-2E2Z
 ESR1
Acute upper respiratory infection
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA07
 DRD3
Skin tag/polyp
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EK71
 MAOA
Lip/oral cavity/pharynx neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B6E
 TP53
Liposarcoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B59
 TP53
Gastroduodenal motor/secretory disorder
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA41
 DRD3
Digestive organ benign neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2E92
 KDR
Carcinoid syndrome
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B10
 ALOX5
Oesophagitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA24
 CYP19A1
Unspecific substance use disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C4Z
 SLC18A2
Thyrotoxicosis
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A02
 IGF1R
Oesophageal/gastroduodenal disorder
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD90
 ACHE
Unspecific substance harmful effect
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: NE6Z
 ACHE
Male infertility
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GB04
 ESR1
Inborn lipid metabolism error
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C52
 CNR2
Metastatic digestive system neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D8Y
 SRC
Skeletal anomaly
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LD24
 ESR1
Testicular cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C80
 EGFR
Multiple structural anomalies syndrome
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LD2F
 IGF1R
Intracerebral haemorrhage
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B00
 EGFR
Ocular cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D00-2D07
 APEX1
Sexually transmitted infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A9Y-1A9Z
 FDPS
Adrenal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D11
 ESR1
Follicular lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A80
 NCT00455416
Stimulant dependence including amphetamines, methamphetamine or methcathinone
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C46.2
 NCT00267657
Septic shock
Disease Category: X.Extension Codes
Disease ICD-11 Code: XS26
 NCT01485315
Central nervous system disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A04-8D87
 NCT01233492
Pulpitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA09.0
 NCT03749408
Impaired glucose tolerance
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A40.1
 NCT02621060
Obstructive sleep apnoea
Disease Category: 07.Sleep-wake disorders
Disease ICD-11 Code: 7A41
 NCT04394143
Diabetic polyneuropathy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C03.0
 NCT02728687
Hypotension
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA20-BA21
 NCT01520207
Other specified non-alcoholic fatty liver disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB92.Y
 NCT04853082
Oligodendroglioma, anaplastic
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH8844
 NCT00303849
Lichen planus
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA91
 NCT01375101
Maternal care for signs of fetal hypoxia
Disease Category: 18.Pregnancy, childbirth or the puerperium
Disease ICD-11 Code: JA86.2
 NCT00189007
Severe acute respiratory syndrome
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D65
 NCT04537299
Malignant neoplasms of other or unspecified parts of mouth
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B66
 NCT05456022
Duchenne muscular dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C70.1
 NCT02964377
Friedreich ataxia
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A03.10
 NCT02660112
Coronary atherosclerosis
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA80
 NCT00000620
Ischaemic heart diseases, unspecified
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA6Z
 NCT00000541
Chronic myeloid leukaemia, NOS
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH4XG8
 NCT03747679
Hearing disorder
Disease Category: 10.Diseases of the ear or mastoid process
Disease ICD-11 Code: AB50-AB57
 NCT05129748
Cocaine use disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C45
 NCT00033033
Xerostomia
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA02.1
 NCT04392622
Cannabis use disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C41
 NCT05432284
Malaria
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F40-1F45
 NCT00113854
Cerebrovascular disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B22-8B2Z
 NCT00000514
Structural developmental anomaly of heart or great vessels, unspecified
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LA8Z
 NCT04217421
Gastro-oesophageal reflux disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA22
 NCT02226484
Congenital aplastic anaemia
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3A70.0
 NCT01720147
Wheezing
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MD11.C
 NCT01142505
Cutaneous T-cell lymphoma, NOS
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH1951
 NCT02448381
Constipation
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: ME05.0
 NCT04534465
Osteoporosis
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FB83.1
 NCT00330096
Postherpetic polyneuropathy
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1E91.5
 NCT02484170
Exposure to or harmful effects of undetermined intent of other or unspecified substances chiefly nonmedicinal as to source
Disease Category: 23.External causes of morbidity or mortality
Disease ICD-11 Code: PH56
 NCT02570971
Mycosis fungoides
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B01
 NCT05380635
Immune thrombocytopenic purpura
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3B64.10
 NCT02351622
Hypercholesterolaemia
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C80.0
 NCT00000620
Intracranial injury, unspecified
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: NA07.Z
 NCT01028339
Atrial fibrillation
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BC81.3
 CA7
Non-alcoholic fatty liver disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB92
 MMP9
Keratoconus
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9A78.50
 CA4
Pre-eclampsia
Disease Category: 18.Pregnancy, childbirth or the puerperium
Disease ICD-11 Code: JA24
 CA4
Polycystic ovary syndrome
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A80.1
 CDK6
Dilated cardiomyopathy
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BC43.0
 ABCG2

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group