CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Hypericum Perforatum

Example Image

PLANiTS DNA barcode

Click for details-----ITS

ACAATCCCTTTGTGAACCCCCGGAAGGATTATTGTCGAAACCTCCAAATGACCCGCGAACTAGTTATCCACAAGTCGGGGGTGTCGTGGGCTTCTGTCCCGGCGCCCCCGTGCCGGGGGTGGCCAGGCGCGCCAAGCTCTTGGCACGGCTGGCCCATCACCTGCCCAACAAACAAACCCCGGCGCGGCACGCGCCAAGGAACTTTTGCATCATAAGAAGTGTAACGCTCCCGGCTGTGCCGGAAATCGGACAACACGGTCGGGGGCTTCCTTCTGTTCATAACAATAACGACTCTCGGCAACGGATATCTAGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGCCTGCCTGGGTGTCACACATCGTCGCCCCCCAAAATCCCGATATCTCGCAAGAGACAATCGGGAATAGGATGGGCGGAAAATGGTCTCCCGTGCGCTCCCGTTCGCGGTTGGCCCAAAAATGAGTTCCTGGCAAAGCAAAGCCACGACCAGCGGTGGTTGTAAGACCCTCGGTACAAGTCGTGAGCCTTGCATTGCTCGTAGGGACATGTTGACCCTGAACGTGATCGAGTAACATCGAACACTCACA

Click for details-----ITS1

Click for details-----ITS2

ATCGTCGCCCCCCAAAATCCCGATATCTYGCAAGASACAATCGGGMATAGGATGGGCGGAAAATGGTCTCCCGTGCGCTCCCGTTCGCGGTTGGCCCAAAAATGAGTTCCTGGCAAAGCAAAGCCACGACCAGCGGTGGTTGTAAGACCCTCGGTACAAGTCGTGAGCCTTGCATTGCTCGTAGGGACATGTTGACCCTGAACGTGATCGAGTAACATCGGAACACTCACAAA

Taxonomic Information

Plant ID: NPO4391
Plant Latin Name: Hypericum Perforatum
Taxonomy Genus: Hypericum
Taxonomy Family: Hypericaceae

Plant External Links:

NCBI TaxonomyDB: 65561
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:

Turkey; Australia; Italy; Turkmenistan; South Africa; India; Lithuania; United States; Albania; Germany; Chile; Greece; Lebanon; Argentina; China; New Zealand; Spain

Traditional Medicine System:

TCM; Homeopathy; Siddha

Medicinal Functions:

Analgesic; Antidepressant; Antiseptic; Antispasmodic; Aromatic; Astringent; Cholagogue; Digestive; Diuretic; Expectorant; Homeopathy; Nervine; Resolvent; Sedative; Stimulant; Vermifuge; Vulnerary

Geographical Distribution

Turkey; Australia; Italy; Turkmenistan; South Africa; Lebanon; India; United States; Albania; Germany; Spain; Chile; Greece; China; Argentina; New Zealand; Lithuania

Geographical Distribution

−

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 1	CYP1B1	Cytochrome P450 1B1	Q16678	CHEMBL4878
Cytochrome P450	Cytochrome P450 family 1	CYP1A2	Cytochrome P450 1A2	P05177	CHEMBL3356
Cytochrome P450	Cytochrome P450 family 1	CYP1A1	Cytochrome P450 1A1	P04798	CHEMBL2231
Cytochrome P450	Cytochrome P450 family 19	CYP19A1	Cytochrome P450 19A1	P11511	CHEMBL1978
Cytochrome P450	Cytochrome P450 family 2	CYP2C19	Cytochrome P450 2C19	P33261	CHEMBL3622
Cytochrome P450	Cytochrome P450 family 3	CYP3A4	Cytochrome P450 3A4	P08684	CHEMBL340
Drug Transporter	SLC superfamily of solute carriers	SLCO1B1	Solute carrier organic anion transporter family member 1B1	Q9Y6L6	CHEMBL1697668
Drug Transporter	SLC superfamily of solute carriers	SLC22A2	Solute carrier family 22 member 2	O15244	CHEMBL1743122
Therapeutic Target	Enzyme	ALPL	Alkaline phosphatase, tissue-nonspecific isozyme	P05186	CHEMBL5979
Therapeutic Target	Enzyme	RECQL	ATP-dependent DNA helicase Q1	P46063	CHEMBL1293236

Clinical trials type	Number of clinical trials
NP level	119
Plant level	20

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT00000152	Randomized Trial of Beta-Carotene and Macular Degeneration	macular degeneration	Beta Carotene (NPC17810)	NP level
NCT00000161	Randomized Trials of Vitamin Supplements and Eye Disease	cataract;macular degeneration	Beta Carotene (NPC17810)	NP level
NCT00000499	Systolic Hypertension in the Elderly Program (SHEP) (Pilot Study)	heart disease;hypertension	Reserpine (NPC88923)	NP level
NCT00000514	Systolic Hypertension in the Elderly Program (SHEP)	cerebrovascular disorder;heart disease;hypertension	Reserpine (NPC88923)	NP level
NCT00000541	Women's Antioxidant and Folic Acid Cardiovascular Study (WAFACS)	myocardial infarction;Myocardial Ischemia	Beta Carotene (NPC17810)	NP level
NCT00000620	Action to Control Cardiovascular Risk in Diabetes (ACCORD)	atherosclerosis;coronary artery disease;Hypercholesterolemia;type 2 diabetes mellitus;hypertension	Reserpine (NPC88923)	NP level
NCT00000645	A Phase I Dose Escalation Study of Synthetic Hypericin in HIV-Infected Patients With Less Than 300 CD4 Lymphocytes	HIV infection	Hypericin (NPC227841)	NP level
NCT00000792	A Pharmacologically Guided Phase I/II Study of Daily Orally Administered Synthetic Hypericin in HIV-Infected Subjects	HIV infection	Hypericin (NPC227841)	NP level
NCT00005805	St. John's Wort in Relieving Fatigue in Patients Undergoing Chemotherapy or Hormone Therapy for Cancer	Chronic Myeloproliferative Disorders\|Fatigue\|Leukemia\|Lymphoma\|Multiple Myeloma and Plasma Cell Neoplasm\|Myelodysplastic Syndromes\|Precancerous Condition\|Unspecified Adult Solid Tumor;Protocol Specific	Hypericum Perforatum	Plant level As single plant
NCT00006395	Drug Interaction Study of Tegretol (Carbamazepine) and St. John's Wort in Normal Volunteers	Healthy	Hypericum Perforatum	Plant level As single plant

Associated Disease of the Plant	Association Type & Detailed Evidence
Acne vulgaris Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED80	MMP2,ESR1
Acquired hypermelanosis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED60	TYR
Acquired hypomelanotic disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED63	MAOA,TYR
Acquired prion disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E01	ESR1
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	DPP4,AKR1B1,AURKB,KDR
Acute ischaemic heart disease, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA4Z	NCT01330589
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	AURKB,NFKB1,PIM1,TP53,FDPS,FLT3,SRC,KDM1A,GSK3B,AXL
Acute upper respiratory infection Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA07	DRD3
Acute/subacute hepatic failure Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB91	NFKB1
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	ACHE,NR1I2,OPRD1,MMP1,CCNB2,CA7,CDK5R1,SLCO1B1,XDH,CBR1,CYP2C9,CDK1,CRHR1,CA12,TSHR,MMP9,GPR84,AURKB,NPSR1

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Hypericum Perforatum

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

Medicinal Functions:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

395 All known Ingredients in Total

243 Ingredients with Acceptable Bioavailablity

174 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Acne vulgaris

Acquired hypermelanosis

Acquired hypomelanotic disorder

Acquired prion disease

Acute diabete complication

Acute ischaemic heart disease, unspecified

Acute myeloid leukaemia

Acute upper respiratory infection

Acute/subacute hepatic failure

Adenocarcinoma of bronchus or lung

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities