• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Luffa Operculata


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GTCGATGCCTAAACATCAAACGACCCGCGAACGCGTTCACGAACTTTCTGTGCCTGGGGGGAGCATCGTCTTGCACGCATGCACCCTCCCGGTGCCTCAACAAAACCCCGGCGCAGGTCGCGCCAAGGAACTCAAACGAATTCGCCCGCCCCCCGCCCCGCCTCGGTGTGCGGAGGGCGGAGCATTCTTGTCGTATTATTCCAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCACCGAGTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCCACGCAACCCCCCTCGGGTGTGTTGCGCAGGTGCGGGCACACGCTGGCCTCCCGTGCGCACCGTCGTGCGGATGGCTTAAATTCGAGTCCTCGGCGCCTGTCGTCGCGACACTACGGTGGTTGATCCAACCTCGGTACCGCGTCGTGACCTCAGTCCGCGCACCTCCTCCTCGCGAGCGAGCGAGGACTTCTATGTCGACCCTCTGAATGTCGTCCCCAAAGACGATGCTCTCGACGCGACCCC

Click for details-----ITS1

NA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO439
Plant Latin Name: Luffa Operculata
Taxonomy Genus: Luffa
Taxonomy Family: Cucurbitaceae

Plant External Links:

NCBI TaxonomyDB: 388295
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

11 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


8 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

2 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC58571

Ingredient ID: NPC52045

Ingredient ID: NPC41336

Ingredient ID: NPC36197

Ingredient ID: NPC294852

Ingredient ID: NPC227797

Ingredient ID: NPC22193

Ingredient ID: NPC22117

Ingredient ID: NPC219926

Ingredient ID: NPC180340

Ingredient ID: NPC145110