• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Leonurus Cardiaca


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

CGGGGCGGCGTCGGGGGGGCAACCTCCCGATGCGGCCCCGAACCCGTCGGTGCGCGCCTTCGTGCCGTGCCGTGCGGGATAACCAACTCGGGCGCGGAATGCGCCAAGGAAAACACAATGGAGCGTTCCCCTCCCCTCCGCGCCCCGTTCGCGGGGCGACGGGGAGCAAGGGACGCCTATCGAATGTCTAAA

Click for details-----ITS2

ATCGTGTTGCCCCCCTCCCCCACGGGGTGGGGCAGAGATTGGCCTGCGCAGCGGCCGACCCAAATGCAAATCTATCGTTGACGCATGTCACGACCAGTGGTGGTTGAACATTCAACTCGCATGTTGTCACGTTCATCGGCGTCATCAGTTGGGAGACGATAAAGAAACCCAATGGCGCGAGCACGCATCGTGCCCACGA
Taxonomic Information

Plant ID: NPO4346
Plant Latin Name: Leonurus Cardiaca
Taxonomy Genus: Leonurus
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 587664
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

11 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


3 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

5 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC80144

Ingredient ID: NPC51700

Ingredient ID: NPC49833

Ingredient ID: NPC38987

Ingredient ID: NPC249171

Ingredient ID: NPC216038

Ingredient ID: NPC194938

Ingredient ID: NPC178887

Ingredient ID: NPC177969

Ingredient ID: NPC143625

Ingredient ID: NPC140498