• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Geranium Sibiricum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAACCCTGCACAGCAGAACGACCCGCGAACTCGTTAATAAACTGCGGGGAGCGGGTGGCGCTTGCGCCCCCCGCAACCTGATGTCGGGGGCTTGGGCGGAAGCCCACGTTGCCCGACAAAAAACGTACCCCCGGCGCGGTCCGCGCCAAGGAATCGAAACGAAGCAACGTTTGTAGTCCGCCCCGTTCGCGGGAAGTGGACGGCAACACGGTCTTCCAATGTATACTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGCGTCACGCGCTCCGTCGCCCCGCAACCCCGAACTCCGAAATGGGCTAGGGTGCTTGTGGTGCGGAGATTGGTCTCCCGTGTGCCTTGCTCGCGGCTGGCCTAAAATTGAGTCCCGGACGCTCTGTTCTGCGGCCGACGGTGGTTGAGAAGCCCTCGAAAATGTGCTGCTGCAGTGTTGCCCGATGTGGACCCTGTGACCCTCGCGCGACCTCTCCCCTTGGGGTGAGGGAGCTCCATCTGAGACCCCAGGTCAGGCGGGGCT

Click for details-----ITS1

NA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO433
Plant Latin Name: Geranium Sibiricum
Taxonomy Genus: Geranium
Taxonomy Family: Geraniaceae

Plant External Links:

NCBI TaxonomyDB: 345237
Plant-of-the-World-Online: 322496-2

Used in Medicines

Country/Region:
China; India; Russia

Traditional Medicine System:
Indian Folk; TCM


Medicinal Functions:

Astringent; Diuretic; Vulnerary

Geographical Distribution

Turkey; Afghanistan; Italy; Mongolia; France; Norway; China; Germany; Kazakhstan; Ukraine; Poland; United States; Hungary; Switzerland; Russia; Pakistan; Romania; South Africa; India; Austria; Japan; Tajikistan

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

107 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


32 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

27 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99016

Ingredient ID: NPC98257

Ingredient ID: NPC97824

Ingredient ID: NPC86688

Ingredient ID: NPC8526

Ingredient ID: NPC84956

Ingredient ID: NPC82839

Ingredient ID: NPC81792

Ingredient ID: NPC80710

Ingredient ID: NPC77349

Ingredient ID: NPC75322

Ingredient ID: NPC7479

Ingredient ID: NPC72194

Ingredient ID: NPC72093

Ingredient ID: NPC71458

Ingredient ID: NPC6298

Ingredient ID: NPC61139

Ingredient ID: NPC56867

Ingredient ID: NPC54538

Ingredient ID: NPC53545

Ingredient ID: NPC52956

Ingredient ID: NPC46801

Ingredient ID: NPC46190

Ingredient ID: NPC45782

Ingredient ID: NPC45677

Ingredient ID: NPC4538

Ingredient ID: NPC44321

Ingredient ID: NPC43094

Ingredient ID: NPC4268

Ingredient ID: NPC39591

Ingredient ID: NPC37852

Ingredient ID: NPC37691

Ingredient ID: NPC37578

Ingredient ID: NPC33747

Ingredient ID: NPC32441

Ingredient ID: NPC313179

Ingredient ID: NPC310098

Ingredient ID: NPC309585

Ingredient ID: NPC305227

Ingredient ID: NPC302780

Ingredient ID: NPC294656

Ingredient ID: NPC294409

Ingredient ID: NPC293832

Ingredient ID: NPC292318

Ingredient ID: NPC292279

Ingredient ID: NPC288426

Ingredient ID: NPC287295

Ingredient ID: NPC281255

Ingredient ID: NPC280102

Ingredient ID: NPC270735

Ingredient ID: NPC263031

Ingredient ID: NPC25913

Ingredient ID: NPC256078

Ingredient ID: NPC255204

Ingredient ID: NPC254942

Ingredient ID: NPC254894

Ingredient ID: NPC254772

Ingredient ID: NPC242419

Ingredient ID: NPC239416

Ingredient ID: NPC237804

Ingredient ID: NPC235126

Ingredient ID: NPC234560

Ingredient ID: NPC230085

Ingredient ID: NPC22845

Ingredient ID: NPC227260

Ingredient ID: NPC226453

Ingredient ID: NPC225710

Ingredient ID: NPC220125

Ingredient ID: NPC21937

Ingredient ID: NPC217741

Ingredient ID: NPC209846

Ingredient ID: NPC209560

Ingredient ID: NPC196638

Ingredient ID: NPC19513

Ingredient ID: NPC194701

Ingredient ID: NPC194293

Ingredient ID: NPC190385

Ingredient ID: NPC186179

Ingredient ID: NPC185137

Ingredient ID: NPC184054

Ingredient ID: NPC18223

Ingredient ID: NPC180145

Ingredient ID: NPC17810

Ingredient ID: NPC17230

Ingredient ID: NPC170052

Ingredient ID: NPC166225

Ingredient ID: NPC165410

Ingredient ID: NPC16366

Ingredient ID: NPC163209

Ingredient ID: NPC15825

Ingredient ID: NPC156694

Ingredient ID: NPC151808

Ingredient ID: NPC150950

Ingredient ID: NPC142108

Ingredient ID: NPC141357

Ingredient ID: NPC139075

Ingredient ID: NPC136176

Ingredient ID: NPC132904

Ingredient ID: NPC130530

Ingredient ID: NPC129185

Ingredient ID: NPC121509

Ingredient ID: NPC120464

Ingredient ID: NPC118773

Ingredient ID: NPC116280

Ingredient ID: NPC114289

Ingredient ID: NPC109504

Ingredient ID: NPC102256