• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Morinda Citrifolia


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAACCTGCACAGCAGAACGACCCGCGAACACGTTGAAAAACACATTTGGGGGGACGTGGGTTTGGGATAAGGGCGACAGCCCCCCTGCCCATGGCCCCTTGCTTGGGCATCGAAGTAAGGTAGCGGAAGCGACCCAACTCCGGCGCCCAAGAAACAAACCCCGACGCAATCCGCGTCAAGGAAAACATTTAACTCGAGGGCGTGTTGTCGTCCCGTCGCCCCCGTTCGCGGGTTGGCGCGCGGGCTGATGGCCGCTTCTTAGTGAAAAACAAAAACGACTCTCGGCAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTAGGCCGAGGGCACGTCTGCATGGGCGTCACGCATCGCGTCGCCCCCCCAATCACTGAGCACCCAGAGTGCTCTTTGGCTTGGTGGGGAGCGGATATTGGCCTCCCGTGCCTTTCGGTGCGGCTGGCTCAAACTTGAGTCCCCTGCGTAGGACGCACGACAAGTGGTGGTTGATAACAAGGCCCTCGCGTCCCGTCGTGCGGCAATCCTCCGCGGGATTTGGCTCGTCACAAGTGACCCTGATGACGCGCCTTCGCGATCCCCACGCATGTGGTGGCCGATGATGGTTGCGCTCCGACCGCGA

Click for details-----ITS1

ATGCATGCGTGAGGCCCCAGCAAGGGGGACGGAAGACCCGCGAACCCGTGAACTGTCGAGGCGGAGGGGCGGCTTCCCCGGCGCGTTCGCGCCGGGGTCGCCCCGCAGGCCGGAACCCCCCGATGTGCCGCCGTGCTCGCGCGGCGGCGGAAGGGACGGGGAGGGGCGTGAGCCCCGACCCTGGGCGCGGCAGCCGCGCCAAGGATCTTGGACCGGCGTTGCCGCCGAGCTTGTCCCGCGCCGCGCCGGCCGGGCCATCTCGGCGTCTGGCCGCTCGCAATAGAAGGATTTGTA

Click for details-----ITS2

ATCGAAGCCTCCTGCCACTTTCCTTTTGACTGGTATTGTGCAGGGTGGATGTTGGCCTCCCGTGAGCTCTTTCGTCTCATGGTTGGTTGAAAATTGAGACCTTGGTAGGGTGTGCCATGATAAATGGTGGTTGTGTGACCCACGAGACCAGTCATGCACGACTCTATTGAATTTGGCCTCTTTTGCCCATATGCGTTTCTAAACGCTCGTGATGAGACCTCAGGTCAGGCGGGGCTAATCACTAGTGAATTCGCGGCCGCCTGCAGGTCGACCATATGGGAGAG
Taxonomic Information

Plant ID: NPO4323
Plant Latin Name: Morinda Citrifolia
Taxonomy Genus: Morinda
Taxonomy Family: Rubiaceae

Plant External Links:

NCBI TaxonomyDB: 43522
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Australia; Philippines; Indonesia; India; Papua New Guinea; Congo; Malaysia; Vietnam; China; Thailand

Traditional Medicine System:
Indian Folk; TCM; Ayurveda; Siddha

Geographical Distribution

Australia; Philippines; Indonesia; India; Papua New Guinea; Malaysia; Congo; China; Vietnam; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

160 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


57 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

78 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98809

Ingredient ID: NPC96806

Ingredient ID: NPC93015

Ingredient ID: NPC92474

Ingredient ID: NPC86412

Ingredient ID: NPC86030

Ingredient ID: NPC79788

Ingredient ID: NPC77296

Ingredient ID: NPC76881

Ingredient ID: NPC7642

Ingredient ID: NPC76336

Ingredient ID: NPC73061

Ingredient ID: NPC72022

Ingredient ID: NPC70204

Ingredient ID: NPC6828

Ingredient ID: NPC66995

Ingredient ID: NPC66667

Ingredient ID: NPC64242

Ingredient ID: NPC62927

Ingredient ID: NPC55920

Ingredient ID: NPC54321

Ingredient ID: NPC53414

Ingredient ID: NPC53206

Ingredient ID: NPC51700

Ingredient ID: NPC50713

Ingredient ID: NPC488547

Ingredient ID: NPC488546

Ingredient ID: NPC488545

Ingredient ID: NPC488544

Ingredient ID: NPC484097

Ingredient ID: NPC484096

Ingredient ID: NPC484095

Ingredient ID: NPC484094

Ingredient ID: NPC476440

Ingredient ID: NPC475928

Ingredient ID: NPC475924

Ingredient ID: NPC475851

Ingredient ID: NPC474730

Ingredient ID: NPC473451

Ingredient ID: NPC471666

Ingredient ID: NPC471665

Ingredient ID: NPC471664

Ingredient ID: NPC47135

Ingredient ID: NPC45428

Ingredient ID: NPC41918

Ingredient ID: NPC40187

Ingredient ID: NPC36817

Ingredient ID: NPC36565

Ingredient ID: NPC33867

Ingredient ID: NPC3356

Ingredient ID: NPC325089

Ingredient ID: NPC324751

Ingredient ID: NPC314350

Ingredient ID: NPC313979

Ingredient ID: NPC312338

Ingredient ID: NPC311890

Ingredient ID: NPC308976

Ingredient ID: NPC307063

Ingredient ID: NPC303859

Ingredient ID: NPC30083

Ingredient ID: NPC300540

Ingredient ID: NPC298255

Ingredient ID: NPC294815

Ingredient ID: NPC294226

Ingredient ID: NPC289758

Ingredient ID: NPC285003

Ingredient ID: NPC28304

Ingredient ID: NPC281471

Ingredient ID: NPC280582

Ingredient ID: NPC271585

Ingredient ID: NPC270249

Ingredient ID: NPC267753

Ingredient ID: NPC26741

Ingredient ID: NPC261117

Ingredient ID: NPC260833

Ingredient ID: NPC259162

Ingredient ID: NPC257682

Ingredient ID: NPC252918

Ingredient ID: NPC250619

Ingredient ID: NPC250545

Ingredient ID: NPC249288

Ingredient ID: NPC248889

Ingredient ID: NPC248500

Ingredient ID: NPC243728

Ingredient ID: NPC241720

Ingredient ID: NPC241265

Ingredient ID: NPC241199

Ingredient ID: NPC238532

Ingredient ID: NPC235665

Ingredient ID: NPC230789

Ingredient ID: NPC228892

Ingredient ID: NPC226723

Ingredient ID: NPC225710

Ingredient ID: NPC224999

Ingredient ID: NPC222887

Ingredient ID: NPC216358

Ingredient ID: NPC216257

Ingredient ID: NPC214729

Ingredient ID: NPC212458

Ingredient ID: NPC212363

Ingredient ID: NPC20791

Ingredient ID: NPC206264

Ingredient ID: NPC202229

Ingredient ID: NPC199837

Ingredient ID: NPC196034

Ingredient ID: NPC195232

Ingredient ID: NPC193741

Ingredient ID: NPC192074

Ingredient ID: NPC19174

Ingredient ID: NPC19101

Ingredient ID: NPC186806

Ingredient ID: NPC182466

Ingredient ID: NPC181465

Ingredient ID: NPC180586

Ingredient ID: NPC177818

Ingredient ID: NPC17743

Ingredient ID: NPC176740

Ingredient ID: NPC176627

Ingredient ID: NPC174668

Ingredient ID: NPC172282

Ingredient ID: NPC171615

Ingredient ID: NPC164957

Ingredient ID: NPC164912

Ingredient ID: NPC163812

Ingredient ID: NPC160777

Ingredient ID: NPC155457

Ingredient ID: NPC154738

Ingredient ID: NPC153870

Ingredient ID: NPC15378

Ingredient ID: NPC153588

Ingredient ID: NPC151968

Ingredient ID: NPC149889

Ingredient ID: NPC148965

Ingredient ID: NPC147335

Ingredient ID: NPC147292

Ingredient ID: NPC146355

Ingredient ID: NPC143227

Ingredient ID: NPC141765

Ingredient ID: NPC141136

Ingredient ID: NPC140777

Ingredient ID: NPC139548

Ingredient ID: NPC133948

Ingredient ID: NPC131747

Ingredient ID: NPC130382

Ingredient ID: NPC129349

Ingredient ID: NPC128986

Ingredient ID: NPC128225

Ingredient ID: NPC126206

Ingredient ID: NPC125892

Ingredient ID: NPC125072

Ingredient ID: NPC121797

Ingredient ID: NPC12040

Ingredient ID: NPC118427

Ingredient ID: NPC116775

Ingredient ID: NPC115207

Ingredient ID: NPC114928

Ingredient ID: NPC114687

Ingredient ID: NPC112274

Ingredient ID: NPC111607

Ingredient ID: NPC100684