• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Elephantopus Mollis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGATGCAATTCAAAACGAACCGTGAACACGTATTGAAAATCTTGGGCTAGGTGAGACGGCCTTGTGCTCGTCAAGCCCATGCCCTGCCAATGGATTTTTATGATGCCTATAAGTAGGCGTCGTAGAAGTCCTGCCGGCAACGTAACAAACCCCGGCACGGAACGTGCCAAGGAACGTAAAAACTCAAGAAGGGTGTGGCGTGGCACATTTCGACATCGGACTTGTGCCCGATTCCACTGCCTTTCAAAATCACAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGTCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCATCACGGCATGTTGAATCGTCAGCATGCCGTCGGGGGCGGAGATTGGTCTCCCATGCCTTTGTGGTGTGGTTGGCCCAAATTGAAGGCCGCCTTGATTGGCACATGACTATTGGTGGTTGAAAAGACCTTCGTTTAAAGTCATGCTGTGAGTCACTGGTAAAATGCCTCATTTAGAACCCTGATGCATCGTGTTTTGATGTCTCGGACGCGACCCCAGGTCA

Click for details-----ITS1

TCGATGCAATTCAAAACGAACCGCGAACACGTATTGAAAATCTCGGGCTAGGCGAGACGGCCTTGTGCTCATCAAGCCCATGCCCCGCCAATGGATTTTTATGATGCCTATAAGTAGGCGTCGTAGAAGTCCTGTCGGCAACGTAACAAACCCCGGCACGGAACGTGCCAAGGAACGTAAAAACTCAAGAAGGGTGTGGCGTGGCACATTTCGACATCCGACTTGTGCCCGGGTCCACTGCCTTTCAAAATCACAAA

Click for details-----ITS2

ATCACGTCGTCCCCACCACGTCATGTATCGTCGGCATGTCGTCGGGGGCGGAGATTAGTCTTCCATGCCATCGCGTGTGGTTGGCCCAAATTGATGGCCGCGTTGATTGGCACACGACTATTGGTGGTTGAAAAAACCTTCGGTCTAGAGTCGTGTTGCGAGTCACCGGTAAAAAGCCTCGTTTAGACCCCTGACGCATCATGATTCGATGCCTCGGAC
Taxonomic Information

Plant ID: NPO4240
Plant Latin Name: Elephantopus Mollis
Taxonomy Genus: Elephantopus
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 318057
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Brazil; China; Philippines; Cameroon

Traditional Medicine System:
TCM

Geographical Distribution

Brazil; China; Philippines; Cameroon

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

94 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


48 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

35 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98081

Ingredient ID: NPC92815

Ingredient ID: NPC91155

Ingredient ID: NPC9096

Ingredient ID: NPC81010

Ingredient ID: NPC80875

Ingredient ID: NPC76336

Ingredient ID: NPC68324

Ingredient ID: NPC67810

Ingredient ID: NPC58190

Ingredient ID: NPC55517

Ingredient ID: NPC51179

Ingredient ID: NPC481994

Ingredient ID: NPC481993

Ingredient ID: NPC45348

Ingredient ID: NPC4467

Ingredient ID: NPC34700

Ingredient ID: NPC326286

Ingredient ID: NPC32053

Ingredient ID: NPC320396

Ingredient ID: NPC312800

Ingredient ID: NPC307103

Ingredient ID: NPC307063

Ingredient ID: NPC305835

Ingredient ID: NPC300564

Ingredient ID: NPC29758

Ingredient ID: NPC296697

Ingredient ID: NPC295204

Ingredient ID: NPC292978

Ingredient ID: NPC292419

Ingredient ID: NPC291407

Ingredient ID: NPC288263

Ingredient ID: NPC288240

Ingredient ID: NPC282214

Ingredient ID: NPC281321

Ingredient ID: NPC278429

Ingredient ID: NPC278128

Ingredient ID: NPC273579

Ingredient ID: NPC268342

Ingredient ID: NPC268181

Ingredient ID: NPC266831

Ingredient ID: NPC26536

Ingredient ID: NPC263371

Ingredient ID: NPC257497

Ingredient ID: NPC254919

Ingredient ID: NPC254211

Ingredient ID: NPC252120

Ingredient ID: NPC250436

Ingredient ID: NPC248276

Ingredient ID: NPC239499

Ingredient ID: NPC230301

Ingredient ID: NPC229818

Ingredient ID: NPC226

Ingredient ID: NPC225696

Ingredient ID: NPC220825

Ingredient ID: NPC219876

Ingredient ID: NPC218161

Ingredient ID: NPC216857

Ingredient ID: NPC213413

Ingredient ID: NPC211739

Ingredient ID: NPC211448

Ingredient ID: NPC197523

Ingredient ID: NPC195334

Ingredient ID: NPC194264

Ingredient ID: NPC193124

Ingredient ID: NPC192638

Ingredient ID: NPC179415

Ingredient ID: NPC170435

Ingredient ID: NPC167948

Ingredient ID: NPC1659

Ingredient ID: NPC165408

Ingredient ID: NPC163011

Ingredient ID: NPC162205

Ingredient ID: NPC160789

Ingredient ID: NPC160512

Ingredient ID: NPC154824

Ingredient ID: NPC153283

Ingredient ID: NPC147014

Ingredient ID: NPC145290

Ingredient ID: NPC141406

Ingredient ID: NPC138810

Ingredient ID: NPC138672

Ingredient ID: NPC137810

Ingredient ID: NPC129439

Ingredient ID: NPC128737

Ingredient ID: NPC126029

Ingredient ID: NPC1244

Ingredient ID: NPC121980

Ingredient ID: NPC1197

Ingredient ID: NPC117618

Ingredient ID: NPC114101

Ingredient ID: NPC113733

Ingredient ID: NPC111882

Ingredient ID: NPC106364