• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Foeniculum Vulgare


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CTTCTTGTAGGGTGAACATGCGGAAGGATCATTGTCGAATCCTCCGATAGCAGAATGACCCGCTAACACGTAAACACATCGGGCGAGCGTCAGAGGGCTTCGGTCCCCTGATTGCAAACCCCCGGTAGGTGTCCCCTCTATGGTGGCCACCGGCCTACGAAATCATCCGGGCGCGGAGTGCGCCAAGGAACTTGAAAATGAATTGTACGTTCGCATCCCGTTAGCGGGCATCGAACGTCATTCCAAAACACAACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAGTGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCAATAGGCCGAGGGCACGTCGTCCTGGGTGTCACACATTTGCTTGCCCCCACCACTCACTCCTTGATGAGATGTGCTGGTTTTTGGGCGGAAATTGGCCTCCCGTGCCTTGTTGTGCGGCTGGTGCAAAAGCGAGTCTCTGGCGGTGGACGTCGTGACATCGGTGGTTGTAAAATACCCTCTTGACTTGTCGCACGAATCCGCGTCATCTTAGTGAGCTCTAGGACCCTTGGGCGCTACACAATCTGTTCGCCCTAA

Click for details-----ITS1

ATCCTTCTTCAGTAGGTGAACCTGCGGAAGCATCATTGTCGCATCCTACGACAGCAGAATGACCCGCTAACACGTCAACTCATCCGGCCAGCGTAAGAGGGCTTTGGTCCCATGACTGCAAACCCGTAGTAGTTGTCCCCTTGGTGGTGGCCACCGGCCTACGTAATCATCCGGGCGAGGACTGCGCCAAGGAACTTGAAAATGAATTGTACGTCAGCATCCCGTTAGCGGGCATTGAACGTCATTCCACAACACAA

Click for details-----ITS2

ATTTGCTTGCCCCCACCACTCACTCCTTGATGAGATGTGCTGGTTTTTGGGCGGAAATTGGCCTCCCGTGCCTTGTTGTGCGGCTGGTGCAAAAGCGAGTCTCTGGCGGTGGACGTCGTGACATCGGTGGTTGTAAAATACCCTCTTGACTTGTCGCACGAATCCGCGTCATCTTAGTGAGCTCTAGGACCCTTGGGCGCTACACAATCTGTTCGCCCTAACTGGACCCCAGTCAGGCGGGACACCCCGTT
Taxonomic Information

Plant ID: NPO42013
Plant Latin Name: Foeniculum Vulgare
Taxonomy Genus: Anethum
Taxonomy Family: Apiaceae

Plant External Links:

NCBI TaxonomyDB: 2849586
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

86 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


72 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

75 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99886

Ingredient ID: NPC99734

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC85813

Ingredient ID: NPC85488

Ingredient ID: NPC81010

Ingredient ID: NPC78551

Ingredient ID: NPC74539

Ingredient ID: NPC71853

Ingredient ID: NPC70744

Ingredient ID: NPC68779

Ingredient ID: NPC66352

Ingredient ID: NPC64176

Ingredient ID: NPC62045

Ingredient ID: NPC57879

Ingredient ID: NPC55412

Ingredient ID: NPC51146

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC489907

Ingredient ID: NPC489877

Ingredient ID: NPC424

Ingredient ID: NPC3649

Ingredient ID: NPC34764

Ingredient ID: NPC33320

Ingredient ID: NPC328447

Ingredient ID: NPC317120

Ingredient ID: NPC313955

Ingredient ID: NPC296337

Ingredient ID: NPC294902

Ingredient ID: NPC290319

Ingredient ID: NPC287331

Ingredient ID: NPC285322

Ingredient ID: NPC281686

Ingredient ID: NPC279121

Ingredient ID: NPC278068

Ingredient ID: NPC278010

Ingredient ID: NPC272614

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC26906

Ingredient ID: NPC265305

Ingredient ID: NPC261831

Ingredient ID: NPC259134

Ingredient ID: NPC246679

Ingredient ID: NPC246165

Ingredient ID: NPC243509

Ingredient ID: NPC237812

Ingredient ID: NPC235260

Ingredient ID: NPC234536

Ingredient ID: NPC226453

Ingredient ID: NPC226027

Ingredient ID: NPC225710

Ingredient ID: NPC219143

Ingredient ID: NPC213876

Ingredient ID: NPC213749

Ingredient ID: NPC208793

Ingredient ID: NPC20791

Ingredient ID: NPC203468

Ingredient ID: NPC198658

Ingredient ID: NPC189436

Ingredient ID: NPC187770

Ingredient ID: NPC185755

Ingredient ID: NPC180871

Ingredient ID: NPC17810

Ingredient ID: NPC177112

Ingredient ID: NPC174246

Ingredient ID: NPC173996

Ingredient ID: NPC169749

Ingredient ID: NPC167400

Ingredient ID: NPC166362

Ingredient ID: NPC156654

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC147983

Ingredient ID: NPC144023

Ingredient ID: NPC138113

Ingredient ID: NPC137958

Ingredient ID: NPC130683

Ingredient ID: NPC126681

Ingredient ID: NPC125062

Ingredient ID: NPC116775

Ingredient ID: NPC11433

Ingredient ID: NPC112890

Ingredient ID: NPC100551