• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Rosmarinus Officinalis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TTCGTAGGGAACTGCGGACGACMTTGTCGAACCTGCAAAGCAGACCGCGAACACGTGTTTAACGCCATCGGGGGCACGACGTGGGGGCAACCCCCATCGTGCCACCGGCCCCCCGCYCGGCATGTTCCCTCGGGCCATGTCKTGCGGGCTAACGAACCCCGGCGCGGAATGCGCCAAGGAAAACTAAACGAAGCGTCCGCCTCCCGCACCCCGTTCGCGGAACGTGCGTGGGGATCGGATGTCTGTCAAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCWTCCCASSGWAAASCASSGGTKGKGGGGCGGATATTGGCCTCCCGTGCGTCTCGATGCGCGGYTGGCCCAAATRCGATCCCTCGGCGACTCGTGTCACGATAAGTGGTGGTTGAAYAACTCAATCTCGCGCGCCGTCGTGCCACTGCGTCGTCCGCATGGGCATCCATCAATGACCCAATGGTATGGTGCCTTAGGGCGCTCTACCTTCGACCGCGACCCCAGGTCAGGCGGGAATGCCCSAYKAAKTTWA

Click for details-----ITS1

TTCGTAGGGAACTGCGGACGACMTTGTCGAACCTGCAAAGCAGACCGCGAACACGTGTTTAACGCCATCGGGGGCACGACGTGGGGGCAACCCCCATCGTGCCACCGGCCCCCCGCYCGGCATGTTCCCTCGGGCCATGTCKTGCGGGCTAACGAACCCCGGCGCGGAATGCGCCAAGGAAAACTAAACGAAGCGTCCGCCTCCCGCACCCCGTTCGCGGAACGTGCGTGGGGATCGGATGTCTGTCAAATGTCAAAA

Click for details-----ITS2

ATCGCGTCGCCCCCCWTCCCASSGWAAASCASSGGTKGKGGGGCGGATATTGGCCTCCCGTGCGTCTCGATGCGCGGYTGGCCCAAATRCGATCCCTCGGCGACTCGTGTCACGATAAGTGGTGGTTGAAYAACTCAATCTCGCGCGCCGTCGTGCCACTGCGTCGTCCGCATGGGCATCCATCAATGACCCAATGGTATGGTGCCTTAGGGCGCTCTACCTTCGACCGCGACCCCAGGTCAGGCGGGAATGCCCSAYKAAKTTWA
Taxonomic Information

Plant ID: NPO42012
Plant Latin Name: Rosmarinus Officinalis
Taxonomy Genus: Salvia
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 39367
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

144 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


132 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

99 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99734

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC88566

Ingredient ID: NPC87828

Ingredient ID: NPC84786

Ingredient ID: NPC83187

Ingredient ID: NPC83088

Ingredient ID: NPC81010

Ingredient ID: NPC78551

Ingredient ID: NPC76145

Ingredient ID: NPC70744

Ingredient ID: NPC70436

Ingredient ID: NPC69162

Ingredient ID: NPC67508

Ingredient ID: NPC66655

Ingredient ID: NPC64176

Ingredient ID: NPC62045

Ingredient ID: NPC61665

Ingredient ID: NPC61

Ingredient ID: NPC60151

Ingredient ID: NPC58970

Ingredient ID: NPC57605

Ingredient ID: NPC55412

Ingredient ID: NPC54087

Ingredient ID: NPC51700

Ingredient ID: NPC50898

Ingredient ID: NPC490320

Ingredient ID: NPC490130

Ingredient ID: NPC490094

Ingredient ID: NPC490066

Ingredient ID: NPC490040

Ingredient ID: NPC490038

Ingredient ID: NPC490037

Ingredient ID: NPC489908

Ingredient ID: NPC489907

Ingredient ID: NPC489899

Ingredient ID: NPC46587

Ingredient ID: NPC39068

Ingredient ID: NPC3649

Ingredient ID: NPC34764

Ingredient ID: NPC331449

Ingredient ID: NPC328447

Ingredient ID: NPC3247

Ingredient ID: NPC317120

Ingredient ID: NPC313955

Ingredient ID: NPC312800

Ingredient ID: NPC31279

Ingredient ID: NPC312132

Ingredient ID: NPC30853

Ingredient ID: NPC29883

Ingredient ID: NPC29710

Ingredient ID: NPC296337

Ingredient ID: NPC294902

Ingredient ID: NPC293454

Ingredient ID: NPC292792

Ingredient ID: NPC290598

Ingredient ID: NPC287331

Ingredient ID: NPC286774

Ingredient ID: NPC285814

Ingredient ID: NPC281686

Ingredient ID: NPC279121

Ingredient ID: NPC279026

Ingredient ID: NPC278068

Ingredient ID: NPC277917

Ingredient ID: NPC277704

Ingredient ID: NPC272614

Ingredient ID: NPC269919

Ingredient ID: NPC26906

Ingredient ID: NPC268647

Ingredient ID: NPC265305

Ingredient ID: NPC258672

Ingredient ID: NPC25771

Ingredient ID: NPC257066

Ingredient ID: NPC255042

Ingredient ID: NPC254156

Ingredient ID: NPC252539

Ingredient ID: NPC249815

Ingredient ID: NPC246165

Ingredient ID: NPC241498

Ingredient ID: NPC237812

Ingredient ID: NPC232247

Ingredient ID: NPC226453

Ingredient ID: NPC226027

Ingredient ID: NPC219876

Ingredient ID: NPC219143

Ingredient ID: NPC216533

Ingredient ID: NPC215632

Ingredient ID: NPC213876

Ingredient ID: NPC213749

Ingredient ID: NPC212070

Ingredient ID: NPC208793

Ingredient ID: NPC203468

Ingredient ID: NPC202189

Ingredient ID: NPC201844

Ingredient ID: NPC20045

Ingredient ID: NPC198658

Ingredient ID: NPC187770

Ingredient ID: NPC185755

Ingredient ID: NPC183579

Ingredient ID: NPC181255

Ingredient ID: NPC180871

Ingredient ID: NPC178383

Ingredient ID: NPC17810

Ingredient ID: NPC177112

Ingredient ID: NPC176589

Ingredient ID: NPC175987

Ingredient ID: NPC175108

Ingredient ID: NPC174246

Ingredient ID: NPC173996

Ingredient ID: NPC168855

Ingredient ID: NPC167400

Ingredient ID: NPC166894

Ingredient ID: NPC166362

Ingredient ID: NPC165525

Ingredient ID: NPC15912

Ingredient ID: NPC155263

Ingredient ID: NPC154480

Ingredient ID: NPC154186

Ingredient ID: NPC152451

Ingredient ID: NPC151620

Ingredient ID: NPC150950

Ingredient ID: NPC147983

Ingredient ID: NPC143292

Ingredient ID: NPC142860

Ingredient ID: NPC142415

Ingredient ID: NPC140616

Ingredient ID: NPC138113

Ingredient ID: NPC137958

Ingredient ID: NPC126707

Ingredient ID: NPC126681

Ingredient ID: NPC122962

Ingredient ID: NPC121098

Ingredient ID: NPC120840

Ingredient ID: NPC120163

Ingredient ID: NPC118561

Ingredient ID: NPC11433

Ingredient ID: NPC112890

Ingredient ID: NPC112734

Ingredient ID: NPC111888

Ingredient ID: NPC110899

Ingredient ID: NPC110789

Ingredient ID: NPC107540

Ingredient ID: NPC105246